Transcriptome Analysis Reveals the Inducing Effect of Bacillus siamensis on Disease Resistance in Postharvest Mango Fruit
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strain
2.2. Plant Materials
2.3. Evaluation of Biocontrol Effect of B. siamensis on Pathogens in Stored Mango Fruit
2.4. Construction and Sequencing of the Transcriptome
2.4.1. Unigene Functional Annotation
2.4.2. Differentially Expressed Genes (DEG) Analysis
2.4.3. GO Enrichment and Pathway Analysis of DEG
2.5. The Quantitative Real-Time PCR (qRT-PCR) Analysis
2.6. Statistical Analysis
3. Results
3.1. The Effect of B. siamensis on Disease Index (DI) of Mango Fruit Stored at 25 °C
3.2. Sequencing and Transcriptome Assembly
3.3. Statistics of Different Expressed Genes (DEGs)
3.4. GO and KEGG Enrichment Analysis of DEGs in Mango Fruit
3.5. Analysis of Differential Expression Genes (DEGs)
3.6. The Key Genes Analysis in Pathways Related with Disease-Resistance of Mango Fruits
3.7. Validation of Gene Expression Profiles by qRT-PCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, L.; Wu, H.X.; Ma, X.W.; Xu, W.T.; Liang, Q.Z.; Zhan, R.L.; Wang, S.B. Transcriptional mechanism of differential sugar accumulation in pulp of two contrasting mango (Mangifera indica L.) cultivars. Genomics 2020, 112, 4505–4515. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Ren, Y.; Chen, C.; Liu, J.; Liu, H.; Pei, Y. Defense Responses of Salicylic Acid in Mango Fruit Against Postharvest Anthracnose, Caused by Colletotrichum gloeosporioides and its Possible Mechanism. J. Food Saf. 2017, 37, e12294. [Google Scholar] [CrossRef]
- Zhang, W.; Jiang, H.; Cao, J.; Jiang, W. UV-C treatment controls brown rot in postharvest nectarine by regulating ROS metabolism and anthocyanin synthesis. Postharvest Biol. Technol. 2021, 180, 111613. [Google Scholar] [CrossRef]
- Chechi, A.; Stahlecker, J.; Dowling, M.E.; Schnabel, G. Diversity in species composition and fungicide resistance profiles in Colletotrichum isolates from apples. Pestic. Biochem. Physiol. 2019, 158, 18–24. [Google Scholar] [CrossRef]
- Sun, C.; Fu, D.; Lu, H.; Zhang, J.; Zheng, X.; Yu, T. Autoclaved yeast enhances the resistance against Penicillium expansum in postharvest pear fruit and its possible mechanisms of action. Biol. Control 2018, 119, 51–58. [Google Scholar] [CrossRef]
- Fernandez-San Millan, A.; Larraya, L.; Farran, I.; Ancin, M.; Veramendi, J. Successful biocontrol of major postharvest and soil-borne plant pathogenic fungi by antagonistic yeasts. Biol. Control 2021, 160, 104683. [Google Scholar] [CrossRef]
- Feng, F.; Chen, X.; Wang, Q.; Xu, W.; Long, L.; Nabil El-Masry, G.; Wan, Q.; Yan, H.; Cheng, J.; Yu, X. Use of Bacillus-siamensis-inoculated biochar to decrease uptake of dibutyl phthalate in leafy vegetables. J. Environ. Manag. 2020, 253, 109636. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Li, M.; Wang, D.; Wang, F.; Shen, H.; Sun, G.; Feng, C.; Wang, X.; Chen, D.; Sun, X. Biocontrol efficacy of Bacillus siamensis LZ88 against brown spot disease of tobacco caused by Alternaria alternata. Biol. Control 2021, 154, 104508. [Google Scholar] [CrossRef]
- Amna; Ud Din, B.; Sarfraz, S.; Xia, Y.; Kamran, M.A.; Javed, M.T.; Sultan, T.; Hussain Munis, M.F.; Chaudhary, H.J. Mechanistic elucidation of germination potential and growth of wheat inoculated with exopolysaccharide and ACC- deaminase producing Bacillus strains under induced salinity stress. Ecotoxicol. Environ. Saf. 2019, 183, 109466. [Google Scholar] [CrossRef]
- Liu, J.; Sui, Y.; Wisniewski, M.; Droby, S.; Liu, Y. Review: Utilization of antagonistic yeasts to manage postharvest fungal diseases of fruit. Int. J. Food Microbiol. 2013, 167, 153–160. [Google Scholar] [CrossRef]
- Syed Ab Rahman, S.F.; Singh, E.; Pieterse, C.M.J.; Schenk, P.M. Emerging microbial biocontrol strategies for plant pathogens. Plant Sci. 2018, 267, 102–111. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.-H.; Ji, Y.-P.; Qu, Y.-Y.; Qi, Y.-K.; Li, D.-W.; Liu, Z.-Y.; Wu, X.-Q. The response strategies of Colletotrichum gloeosporioides s.s. due to the stress caused by biological control agent Bacillus amyloliquefaciens deciphered by transcriptome analyses. Biol. Control 2020, 150, 104372. [Google Scholar] [CrossRef]
- Yang, R.; Lin, X.; Dou, Y.; Zhang, W.; Du, H.; Wan, C.; Chen, J.; Zhang, L.; Zhu, L. Transcriptome profiling of postharvest kiwifruit in response to exogenous nitric oxide. Sci. Hortic. 2021, 277, 109788. [Google Scholar] [CrossRef]
- Zhao, J.; Zhang, D.; Wang, Z.; Tian, Z.; Yang, F.; Lu, X.; Long, C.A. Genome sequencing and transcriptome analysis of Geotrichum citri-aurantii on citrus reveal the potential pathogenic- and guazatine-resistance related genes. Genomics 2020, 112, 4063–4071. [Google Scholar] [CrossRef]
- Xu, M.; Zhang, X.; Li, D.; Gu, X.; Godana, E.A.; Dhanasekaran, S.; Zhao, L.; Zhang, H. Transcriptome analysis of postharvest grapes in response to Talaromyces rugulosus O1 infection. Postharvest Biol. Technol. 2021, 178, 111542. [Google Scholar] [CrossRef]
- You, W.; Ge, C.; Jiang, Z.; Chen, M.; Li, W.; Shao, Y. Screening of a broad-spectrum antagonist-Bacillus siamensis, and its possible mechanisms to control postharvest disease in tropical fruits. Biol. Control 2021, 157, 104584. [Google Scholar] [CrossRef]
- Palani, S.N.; Elangovan, S.; Menon, A.; Kumariah, M.; Tennyson, J. An efficient nucleic acids extraction protocol for Elettaria cardamomum. Biocatal. Agric. Biotechnol. 2019, 17, 207–212. [Google Scholar] [CrossRef]
- Hong, K.; Gong, D.; Zhang, L.; Hu, H.; Jia, Z.; Gu, H.; Song, K. Transcriptome characterization and expression profiles of the related defense genes in postharvest mango fruit against Colletotrichum gloeosporioides. Gene 2016, 576, 275–283. [Google Scholar] [CrossRef] [PubMed]
- Gorai, P.S.; Ghosh, R.; Mandal, S.; Ghosh, S.; Chatterjee, S.; Gond, S.K.; Mandal, N.C. Bacillus siamensis CNE6—A multifaceted plant growth promoting endophyte of Cicer arietinum L. having broad spectrum antifungal activities and host colonizing potential. Microbiol. Res. 2021, 252, 126859. [Google Scholar] [CrossRef]
- Zhang, X.; Gao, Z.; Zhang, X.; Bai, W.; Zhang, L.; Pei, H.; Zhang, Y. Control effects of Bacillus siamensis G-3 volatile compounds on raspberry postharvest diseases caused by Botrytis cinerea and Rhizopus stolonifer. Biol. Control 2020, 141, 104135. [Google Scholar] [CrossRef]
- Zhao, L.; Zhu, H.; Li, B.; Legrand Ngolong Ngea, G.; Gu, X.; Zhang, X.; Dhanasekaran, S.; Zhang, H. Transcriptomic analysis of the disease-resistance response in mandarins induced by the biocontrol yeast, Yarrowia lipolytica. Biol. Control 2021, 163, 104607. [Google Scholar] [CrossRef]
- Christopoulos, M.V.; Tsantili, E. Participation of phenylalanine ammonia-lyase (PAL) in increased phenolic compounds in fresh cold stressed walnut (Juglans regia L.) kernels. Postharvest Biol. Technol. 2015, 104, 17–25. [Google Scholar] [CrossRef]
- Postel, S.; Kemmerling, B. Plant systems for recognition of pathogen-associated molecular patterns. Semin. Cell Dev. Biol. 2009, 20, 1025–1031. [Google Scholar] [CrossRef] [PubMed]
- Bari, R.; Jones, J.D. Role of plant hormones in plant defence responses. Plant Mol. Biol. 2009, 69, 473–488. [Google Scholar] [CrossRef] [PubMed]
- An, N.; Lv, J.; Zhang, A.; Xiao, C.; Zhang, R.; Chen, P. Gene expression profiling of papaya (Carica papaya L.) immune response induced by CTS-N after inoculating PLDMV. Gene 2020, 755, 144845. [Google Scholar] [CrossRef]
- Yuan, G.; He, X.; Li, H.; Xiang, K.; Liu, L.; Zou, C.; Lin, H.; Wu, J.; Zhang, Z.; Pan, G. Transcriptomic responses in resistant and susceptible maize infected with Fusarium graminearum. Crop J. 2020, 8, 153–163. [Google Scholar] [CrossRef]
- Yang, Y.; Liu, J.; Zhou, X.; Liu, S.; Zhuang, Y. Transcriptomics analysis unravels the response to low temperature in sensitive and tolerant eggplants. Sci. Hortic. 2020, 271, 109468. [Google Scholar] [CrossRef]
- Li, C.; Shi, L.; Wang, Y.; Li, W.; Chen, B.; Zhu, L.; Fu, Y. Arabidopsis ECAP Is a New Adaptor Protein that Connects JAZ Repressors with the TPR2 Co-repressor to Suppress Jasmonate-Responsive Anthocyanin Accumulation. Mol. Plant 2020, 13, 246–265. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Zhang, W.-H.; Ma, L.-Y.; Li, X.; Zhao, F.-Y.; Tan, X.-L. Overexpression of Brassica napus NPR1 enhances resistance to Sclerotinia sclerotiorum in oilseed rape. Physiol. Mol. Plant Pathol. 2020, 110, 101460. [Google Scholar] [CrossRef]
- Yu, X.; Xu, G.; Li, B.; de Souza Vespoli, L.; Liu, H.; Moeder, W.; Chen, S.; de Oliveira, M.V.V.; Ariadina de Souza, S.; Shao, W.; et al. The Receptor Kinases BAK1/SERK4 Regulate Ca(2+) Channel-Mediated Cellular Homeostasis for Cell Death Containment. Curr. Biol. 2019, 29, 3778–3790.e3778. [Google Scholar] [CrossRef]
- Elmore, J.M.; Griffin, B.D.; Walley, J.W. Advances in functional proteomics to study plant-pathogen interactions. Curr. Opin. Plant Biol. 2021, 63, 102061. [Google Scholar] [CrossRef]
- Long, L.; Xu, F.C.; Zhao, J.R.; Li, B.; Xu, L.; Gao, W. GbMPK3 overexpression increases cotton sensitivity to Verticillium dahliae by regulating salicylic acid signaling. Plant Sci. 2020, 292, 110374. [Google Scholar] [CrossRef]
- Li, C.; Wang, J.; Ji, N.; Lei, C.; Zhou, D.; Zheng, Y.; Wang, K. PpHOS1, a RING E3 ubiquitin ligase, interacts with PpWRKY22 in the BABA-induced priming defense of peach fruit against Rhizopus stolonifer. Postharvest Biol. Technol. 2020, 159, 111029. [Google Scholar] [CrossRef]
- Qiu, H.; Su, L.; Wang, H.; Zhang, Z. Chitosan elicitation of saponin accumulation in Psammosilene tunicoides hairy roots by modulating antioxidant activity, nitric oxide production and differential gene expression. Plant Physiol. Biochem. 2021, 166, 115–127. [Google Scholar] [CrossRef] [PubMed]
- Singh, B.; Kaur, N.; Kumar, P.; Hallan, V.; Pati, P.K. Reactive oxygen species generating and scavenging systems play critical role in conferring leaf spot disease resistance in Withania somnifera (L.) Dunal. Ind. Crop. Prod. 2020, 157, 112889. [Google Scholar] [CrossRef]
- Akbarian, A.; Rahimmalek, M.; Sabzalian, M.R.; Hodaei, M. Sequencing and phylogenetic analysis of phenylalanine ammonia lyase (pal) and chalcone synthase (chs) genes in some Iranian endemic species of Apiaceae. Gene Rep. 2021, 23, 112889. [Google Scholar] [CrossRef]
- Lu, D.; Zhiqiang, H.; Di, L.; Pengfang, Z.; Shengjin, L.; Na, L.; Hongyu, M. Transcriptome analysis of chrysanthemum in responses to white rust. Sci. Hortic. 2018, 233, 421–430. [Google Scholar] [CrossRef]
- You, X.; Fang, H.; Wang, R.; Wang, G.-L.; Ning, Y. Phenylalanine ammonia lyases mediate broad-spectrum resistance to pathogens and insect pests in plants. Sci. Bull. 2020, 65, 1425–1427. [Google Scholar] [CrossRef]
- Dehghan, S.; Sadeghi, M.; Poppel, A.; Fischer, R.; Lakes-Harlan, R.; Kavousi, H.R.; Vilcinskas, A.; Rahnamaeian, M. Differential inductions of phenylalanine ammonia-lyase and chalcone synthase during wounding, salicylic acid treatment, and salinity stress in safflower, Carthamus tinctorius. Biosci. Rep. 2014, 34, e00114. [Google Scholar] [CrossRef]
- Gharibi, S.; Sayed Tabatabaei, B.E.; Saeidi, G.; Talebi, M.; Matkowski, A. The effect of drought stress on polyphenolic compounds and expression of flavonoid biosynthesis related genes in Achillea pachycephala Rech.f. Phytochemistry 2019, 162, 90–98. [Google Scholar] [CrossRef]
- Wang, R.; Wang, G.L.; Ning, Y. PALs: Emerging Key Players in Broad-Spectrum Disease Resistance. Trends Plant Sci. 2019, 24, 785–787. [Google Scholar] [CrossRef]
- Irani, S.; Todd, C.D.; Wei, Y.; Bonham-Smith, P.C. Changes in phenylpropanoid pathway gene expression in roots and leaves of susceptible and resistant Brassica napus lines in response to Plasmodiophora brassicae inoculation. Physiol. Mol. Plant Pathol. 2019, 106, 196–203. [Google Scholar] [CrossRef]
- Xoca-Orozco, L.A.; Aguilera-Aguirre, S.; Vega-Arreguin, J.; Acevedo-Hernandez, G.; Tovar-Perez, E.; Stoll, A.; Herrera-Estrella, L.; Chacon-Lopez, A. Activation of the phenylpropanoid biosynthesis pathway reveals a novel action mechanism of the elicitor effect of chitosan on avocado fruit epicarp. Food Res. Int. 2019, 121, 586–592. [Google Scholar] [CrossRef] [PubMed]
- Vogt, T. Phenylpropanoid biosynthesis. Mol. Plant 2010, 3, 2–20. [Google Scholar] [CrossRef] [Green Version]
- Jiang, L.; Wu, P.; Yang, L.; Liu, C.; Guo, P.; Wang, H.; Wang, S.; Xu, F.; Zhuang, Q.; Tong, X.; et al. Transcriptomics and metabolomics reveal the induction of flavonoid biosynthesis pathway in the interaction of Stylosanthes-Colletotrichum gloeosporioides. Genomics 2021, 113, 2702–2716. [Google Scholar] [CrossRef]
- Lei, H.; Niu, T.; Song, H.; Bai, B.; Han, P.; Wang, Z.; Liu, A. Comparative transcriptome profiling reveals differentially expressed genes involved in flavonoid biosynthesis between biennial and triennial Sophora flavescens. Ind. Crop. Prod. 2021, 161, 11321. [Google Scholar] [CrossRef]
- Li, R.; Li, Y.; Zhang, Y.; Sheng, J.; Zhu, H.; Shen, L. Transcriptome analysis reveals that SlNPR1 mediates tomato fruit resistance against Botrytis cinerea by modulating phenylpropanoid metabolism and balancing ROS homeostasis. Postharvest Biol. Technol. 2021, 172, 111382. [Google Scholar] [CrossRef]
Primers | Gene Symbol | Sequences |
---|---|---|
ACTIN-F ACTIN-R | AATGGAACTGGAATGGTCAAGGC TGCCAGATCTTCTCCATGTCATCCCA | |
Unigene0007915-F Unigene0007915-R | PR1 | GCTCTCTTCTTCCCCTCCT TTCTCGCCATATTTCCCAC |
Unigene0044045-F Unigene0044045-R | NPR1 | CTCGGCCATCAGATCTCACA GAAGATCGTCACCAGCCATAG |
Unigene0050535-F Unigene0050535-R | BAK1 | CCTAACGGGAGATATTCCTGTCAATGG GAGGAGGTGGAGATACTGGAAGAGG |
Unigene0003608-F Unigene0003608-R | GH3 | ATCAGGAGGGGAGAGAAAG CACAAGGCCACCAGGAGTC |
Unigene0014220-F Unigene0014220-R | WRKY2 | CCTAACCGCCGATCAGCCATTG TCCAATCAAGAGTTCCAGCAGTAGTTC |
Unigene0053866-F Unigene0053866-R | WRKY22 | CTTCAAACAACGACAACAGCCTAAGC TTCTGGAACTTGGCAAACCCTCTTC |
Unigene0027317-F Unigene0027317-R | PTI6 | GACGACGAAGCCTGTCACCATC TGGGTTTCTTCTTTCTGGAGGGTTTG |
Unigene0049558-F Unigene0049558-R | MPK3 | ACTCTTCAGATTACACTGCCGCAATAG CTGCCTGGAAATAGAGGTCTTCTGTTC |
Unigene0019931-F Unigene0019931-R | IDH1 | CGTCATTACCGGGTTCATCAG TCCCTGATTCAACCGTTCCA |
Unigene0038013-F Unigene0038013-R | CAT | CACATTCAAGAGGACTGGAGGATTCTG CCCAAATCATCAAACAGGAAGGTGAAC |
Unigene0031800-F Unigene0031800-R | SOD1 | ACGGCTTCCATATTCACGCTCTTG CGGCAATAATGTTACCCAAATCACCAG |
Unigene0020382-F Unigene0020382-R | SOD2 | CATCACCAGAAGCACCACCAGAC CAGACCTCCGCCGTTGAACTTG |
Unigene0008516-F Unigene0008516-R | PAL | CTCCGTCAAGAACTGCGTCACC GGTCGTCGGCATAGCTGAACAC |
Unigene0006190-F Unigene0006190-R | 4CL | AAGAGGACGAGAGCCAA AGCCGCCCCAGATAATA |
Raw Sequences and Assembly Statistics | Number |
Raw reads (paired-end) | 850,798,964 |
clean reads (paired-end) | 839,584,440 |
GC content percentage | 38.9311 |
Total unigenes(average length; N50; min–max length) | 56,704 (1114; 2058; 201–17,696) |
Bioinformatics Annotations of Mango Fruit Unigenes | |
Gene annotation against Nr (%) | 35,499 (62.60) |
Gene annotation against Swiss-Prot (%) | 24,644 (43.46) |
Gene annotation against KOG (%) | 20,152 (35.54) |
Gene annotation against KEGG (%) | 33,217 (58.58) |
All unigenes annotated (%) | 35,648 (62.87) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jiang, Z.; Li, R.; Tang, Y.; Cheng, Z.; Qian, M.; Li, W.; Shao, Y. Transcriptome Analysis Reveals the Inducing Effect of Bacillus siamensis on Disease Resistance in Postharvest Mango Fruit. Foods 2022, 11, 107. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11010107
Jiang Z, Li R, Tang Y, Cheng Z, Qian M, Li W, Shao Y. Transcriptome Analysis Reveals the Inducing Effect of Bacillus siamensis on Disease Resistance in Postharvest Mango Fruit. Foods. 2022; 11(1):107. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11010107
Chicago/Turabian StyleJiang, Zecheng, Rui Li, Yue Tang, Ziyu Cheng, Minjie Qian, Wen Li, and Yuanzhi Shao. 2022. "Transcriptome Analysis Reveals the Inducing Effect of Bacillus siamensis on Disease Resistance in Postharvest Mango Fruit" Foods 11, no. 1: 107. https://0-doi-org.brum.beds.ac.uk/10.3390/foods11010107