Genetic Diversity of Sweet Potato (Ipomoea batatas L. Lam) Germplasms Collected Worldwide Using Chloroplast SSR Markers
by
,
Kyung Jun Lee
†
,
Gi-An Lee
†,
Jung-Ro Lee
,
Raveendar Sebastin
,
Myoung-Jae Shin
,
Gyu-Taek Cho
and
Do Yoon Hyun
* National Agrobiodiversity Center, National Institute of Agricultural Sciences (NAS), RDA, Jeonju 54874, Korea
*
Author to whom correspondence should be addressed.
†
The first two authors equally contributed.
Agronomy 2019, 9(11), 752; https://doi.org/10.3390/agronomy9110752
Submission received: 10 October 2019
/
Revised: 6 November 2019
/
Accepted: 11 November 2019
/
Published: 13 November 2019
(This article belongs to the Special Issue Analysis of Crop Genetic and Germplasm Diversity)
Abstract
:Sweet potato (Ipomoea batatas L. Lam) is an important food crop widely cultivated in the world. In this study, nine chloroplast simple sequence repeat (cpSSR) markers were used to analyze the genetic diversity and relationships of 558 sweet potato accessions in the germplasm collection of the National Agrobiodiversity Center (NAC). Eight of the nine cpSSR showed polymorphisms, while Ibcp31 did not. The number of alleles per locus ranged from two to four. In general, the Shannon index for each cpSSR ranged from 0.280 to 1.123 and the diversity indices and unbiased diversity ranged from 0.148 to 0.626, and 0.210 to 0.627, respectively. Results of the median-joining network showed 33 chlorotypes in 558 sweet potato accessions. In factor analysis, 558 sweet potato accessions were divided into four clusters, with clusters I and II composed only of the sweet potato accessions from Korea, Japan, Taiwan, and the USA. The results of this study confirmed that the genetic diversity of the female parents of sweet potato accessions conserved at the NAC is low and therefore more sweet potato accessions need to be collected. These results will help to establish an efficient management plan for sweet potato genetic germplasms at the NAC.
1. Introduction
Plant genetic resource, one of the most essential natural resources, has been a research topic resulting in major advancement in the field [1]. Gene banks are concerned with the maintenance of crop resource genetic variations, and plant genetic resource conservation is now receiving greater attention [1,2]. In order to establish effective and efficient conservation practices for plant genetic resources, understanding the genetic diversity between and within population is important [3].
Sweet potato (Ipomoea batatas L. Lam.) is a vegetative propagation crop that belongs to the family Convolvulaceae [4]. The origin of sweet potato is either the Central or South America [5]. Sweet potato is attractive to resource-poor farmers because they have the highest rate of production per unit area/time [6]. It also has a short growth period and is easily propagated and grown with good production in various climates and farming systems [7].
Molecular techniques have been widely adopted as powerful tools for germplasm characterization, cultivar identification, phylogenetic studies, and diversity analysis in many crop plants [8]. In sweet potato studies, molecular markers have been used to evaluate the phylogenetics and germplasm to study the origin of sweet potato and its dissemination [9]. Random amplified polymorphic DNA (RAPD), DNA amplification fingerprinting (DAF), and simple sequence repeat (SSR) markers have been used for the estimation of genetic diversity and genetic relationships [6,8,10,11]. Previous studies have explained the genetic diversity and origin of sweet potato landraces in Mexico, Peru, and New Guinea using chloroplast and nuclear SSR [12,13].
During early genome sequencing projects, chloroplast DNAs (cpDNAs) were of interest because of their small size [14]. The chloroplast (CP) genome was observed in an extremely conserved manner not only in terms of gene numbers, but also in their arrangement [15]. CpSSR derived from the chloroplast genome represents ideal complementary molecular tools to nuclear genetic markers. This is because the SSR loci in the chloroplast genome are often distributed throughout the noncoding regions where higher sequence variations exist, shown to be due to low evolutionary rate and an almost nonexistent recombination rate in chloroplast DNA [16,17,18]. Therefore, cpSSR markers can be used to investigate population genetics and biogeography, and unravel the genetic relationships of closely related species [19].
During the 18th century, sweet potatoes were brought from Japan to various parts of Korea as a famine-relief crop [20]. At present, about 700 sweet potato germplasms have been collected worldwide at the National Agrobiodiversity Center (NAC) at the Rural Development Administration in Korea. However, analysis of genetic diversity in the preserved sweet potato accessions in NAC is lacking. Therefore, it is necessary to learn the genetic relationship of the sweet potato accessions to efficiently manage sweet potato germplasms. In this study, 558 sweet potato accessions conserved at the NAC were analyzed using nine cpSSRs to evaluate the genetic diversity and determine the appropriate panel of sweet potato germplasm for sweet potato improvement and conservation.
2. Materials and Methods
2.1. Plant Materials
Fresh leaves were randomly collected from five to ten individuals selected from 558 sweet potato (Ipomoea Batatas (L.) Lam) accessions conserved at the National Agrobiodiversity Center (NAC) in South Korea. The 558 sweet potato accessions were collected from ten countries including 190 accessions from South Korea (KOR), 123 from Japan (JPN), 73 from Taiwan (TWN), 50 from Peru (PER), 43 from China (CHN), 30 from Indonesia (IDN), 25 from the United States (USA), nine from the Philippines (PHL), nine from New Zealand (NZE), and six from North Korea (PRK) (Table 1 and Table S1).
2.2. DNA Extraction
DNA was extracted from 100 mg of freeze-dried leaves in each sweet potato accession. The DNeasy plant mini kit (Qiagen, Hilden, Germany) was used for the extractions. The DNA quality and quantity of each sample were determined by electrophoresis in 1% (w/v) agarose gels and spectrophotometry (Epoch, BioTek, Winooski, VT, USA). The extracted DNA was diluted to 30 ng/uL and was stored at −20 °C until further PCR amplification.
2.3. Chloroplast SSR Genotyping
For chloroplast SSR analysis, a total of nine cpSSRs were fluorescently labelled (6-FAM, HEX, and NED) and used for detection of the amplification products (Table 2). The PCR reactions were carried out in a 25 uL mixture containing 30 ng template DNA, 1x PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTPs, 0.5 um of each primer, and 1 U Taq polymerase (Inclone, Seongnam, Korea). The amplification was performed with cycling conditions of an initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1 min, and a final extension step at 72 °C for 10 min. Each amplicon was resolved on an ABI Prism 3500 DNA sequencer (ABI3500, Thermo Fisher Scientific Inc., Wilmington, DE, USA) and was scored using Gene Mapper Software (Version 4.0, Thermo Fisher Scientific Inc., Wilmington, DE, USA)
2.4. Data Analysis
The number of observed alleles (Na) for each cpSSR locus was counted for all sweet potato accessions. The effective number of alleles (Ne = 1/(Sum pi^2)), the Shannon index ((I = −1 × Sum (pi × Ln (pi)), the frequency of the I allele), the diversity index (h = 1 − Sum pi^2), and the unbiased diversity (uh = (N/(N − 1)) × h) were calculated using GenAlEx 6.5 [21]. Genetic differentiation between the populations was determined using PhiPT, a measure that allows intra-individual variation to be suppressed and is therefore ideal for comparing cpSSR data with 999 permutations using GenAlEx. Estimates of gene flow (Nm, number of migrants per generation = [(1/PhiPT) − 1]/2) were also calculated by GenAlEx. Analysis of molecular variance (AMOVA), among and within the subpopulations (assigned by the median-joining network), was performed in GenAlEx. To calculate distances based on the cpSSR data, DARwin v.6.0 was employed to generate genetic distance matrix, which were then used to perform factor analysis [22]. To examine the relationship between the 558 sweet potato accessions, a median-joining network was generated using poppr packages on R packages [23] and visualized using Network 5 [24].
3. Results
A total of 21 alleles were detected in eight polymorphic cpSSR loci among the 558 sweet potato germplasms. As shown in Table 3, the Na ranged from two to four and the Ne was calculated to range from 1.174 to 2.675. Shannon’s information (I) for each cpSSR ranged from 0.280 to 1.123 and the diversity indices (h) and uh ranged from 0.148 to 0.626 and 0.148 to 0.627, respectively.
The diversity indices among the ten countries were calculated to be Ne = 1.52, I = 0.44, and h = 0.29 (Table 4). The Na ranged from 1.44 (PRK) to 2.22 (JPN) and the Ne was calculated to be 1.25 (PRK) to 1.77 (TWN). Shannon’s information (I) ranged from 0.23 (PRK) to 0.61 (JPN). The diversity indices (h) and uh were 0.15 (PRK) to 0.39 (JPN) and 0.19 (PRK) to 0.39 (JPN), respectively.
To improve understanding of the genetic relationships between different chloroplast haplotypes, a network approach was used (Figure 1). A total of 77 different chloroplast haplotypes in sweet potato germplasms were identified according to the results of the median-joining network (Table 5). Forty-four of the 77 different chloroplast haplotypes were found only once. Among the 33 chloroplast haplotypes with two or more sweet potato accessions, H1 and H2 were clearly dominant and were distributed over all areas, except for North Korea and New Zealand. The number of chloroplast haplotypes per country ranged from 3 to 41 with an average of fifteen. The diversity of chloroplast haplotypes ranged from 0.216 to 0.833 with an average of 0.37. Although the number of sweet potato accessions in North Korea was the lowest (six), the diversity of chloroplast haplotypes was the highest (five types, 83.3%) among the countries studied. South Korea showed the lowest diversity at 21.6%, displaying only 27 chloroplast haplotypes out of 190 sweet potato accessions.
Factorial analysis (FA) was used to investigate the genetic relationship among the chloroplast haplotypes of the 558 sweet potato accessions. The sweet potato chloroplast haplotypes formed four main clusters defined by the first axis (Figure 2A), which explained 54.1% of the total variances, while the second axis explained 9.5% of the total variances. Cluster I contained 51 sweet potato accessions with five chloroplast haplotypes (H5, H9, H13, H14, and H21). Cluster II consisted of 29 accessions and showed four chloroplast haplotypes, H8, H12, H25, and H26. Cluster III had the most sweet potato accessions (268 accessions) and chloroplast haplotypes (H1, H3, H10, H16, H17, H18, H19, H20, H22, H27, H31, H32, and H33) than the other clusters. Cluster IV had 168 accessions and 11 chloroplast haplotypes (H2, H6, H11, H15, H23, H24, H30, H4, H7, H28, and H29). Among the four clusters, clusters III and IV were distributed across all ten collected countries, while I and II were found only in four countries: Korea, Japan, Taiwan, and the USA (Figure 2B).
The AMOVA analysis performed on the whole sweet potato germplasms indicated 88% total genetic diversity within the populations and 12% total genetic diversity among the populations (Table 6). The genetic differences (PhiPT) among the populations were estimated by AMOVA to be 0.125. The gene flow (genetically effective migration rate, Nm) among the populations was indirectly calculated from the PhiPT as 3.513. In addition, based on factorial analysis, AMOVA of the four clusters was conducted. The analysis revealed that 9, 36, and 4% of the total genetic diversity of the populations was attributable to clusters I, III, and IV, respectively, while cluster II was not significant (p > 0.05). The PhiPT of cluster I, III, and IV were 0.093, 0.361, and 0.042 and the gene flow of each cluster was 4.870, 0.885, and 11.370, respectively.
4. Discussion
In this study, the genetic diversity of 558 sweet potato germplasms conserved in the Genebank was profiled using nine cpSSRs. The results confirmed that the sweet potato germplasms showed various genetic variations depending on the country of collection. Previous studies have been performed to analyze the genetic diversity in sweet potato using molecular markers such as AFLP, RAPD, and SSR [6,8,10,11,25]. In addition, the origin and genetic diversity of sweet potato germplasms have been explained using nuclear SSRs and cpSSRs [12,13]. These methods, non-recombinant and uniparentally inherited nature, are widely used for evolutionary and phylogenetic studies as they have been demonstrated to be effective indicators of the genetic structure of a population [26,27].
In this study, 92.4% of the accessions were included in the breeding lines or cultivars among the 558 sweet potato germplasms. Many other genetic resource centers showed a similar composition of preserved sweet potato accessions. The International Potato Center (CIP) reported that 93.3% of the sweet potato accessions in 36 international germplasm centers were cultivars or breeding lines and that only seven centers were preserving the wild type [28]. There appears to be a higher frequency of breeding line or cultivars due to the breeding system of sweet potatoes. In general, numerous seedlings of posterities resulting from crossing elite parent sweet potatoes were screened for desirable traits and the best were used, with or without the best parents. The undesirable genotypes were discarded through a selection process that concentrated on eliminating the poorest, rather than on selecting the best genotypes [29]. In Japan, they harvested approximately 50,000 seeds from cross combinations and selected approximately 3000 individual seedling plants. After that, they conducted various tests for line selection and generated cultivars or maintained elite breeding lines [4]. For example, cv. ‘Beniazuma’ was released by the Institute of Crop Science, NARO (NICS) in 1984 and is the progeny of a cross between ‘Kanto No. 85’ and ‘Koganesenga’ [30]. Similarly, ‘Quick Sweet’ was released by the NICS in 2002 and is the progeny of a cross between ‘Beniazuma’ and Kyushu No. 30′ [31]. Additionally, ‘Aikomachi’ was released by the NICS in 2012 and was derived from a cross between ‘Quick Sweet’ and ‘Kankei107’ [32]. These three cultivars may show the same patterns in cpSSRs profiling because they have the same maternal pedigree, even though they have different cross combinations. The Korean method is similar to the method of Japanese sweet potato breeding. For example, Korean sweet potato cultivars (cvs), ‘Pungmi’, Yeonmi’, ‘Sinyulmi’, and ‘Gogeonmi’ were derived from cv. ‘Seonmi’ while cvs. ‘Seonmi’, ‘Jinmi’, and ‘Eunmi’ were derived from cv. ‘Hwangmi’. Seven Korean sweet potato cultivars (‘Pungmi’, Yeonmi’, ‘Sinyulmi’, ‘Gogeonmi’ ‘Seonmi’, ‘Jinmi’, and ‘Eunmi’) have the same cpSSRs patterns because they share the same maternal pedigree, even though they have different cross combinations. Due to the frequent use and preservation of these elite accessions, it is possible that conserved sweet potato germplasms such as the breeding lines or cultivars showed the same patterns of cpSSRs.
Among the 558 sweet potato accessions collected from ten countries, sweet potato germplasms from Japan, Korea, Taiwan, and the USA showed four types while other countries had only two types (Figure 2). The Korean sweet potato germplasm collection was started from Japanese varieties. In 1906, 1923, and 1934, Japanese varieties Genki, Shirofuku, and Okinawa No. 100 were introduced and cultivated throughout Korea, respectively. The collection of sweet potato germplasms in Korea began in 1973, led by the international agricultural institutes, International Potato Center (CIP) and World Vegetable Center (AVRDC). In Korean landraces, superior sweet potato lines were selected during breeding programs processes. Although the collection of sweet potatoes was not smooth due to problems with the Peruvian government’s approval by CIP, sweet potato germplasms were obtained from AVRDC, USDA, and Japan [33].
A previous study reported that variation in the maternally-inherited plant genomes affected both type weight and root weight in sweet potatoes [34]. In addition, it was also mentioned that the selection of Nancy Hall and Tainung 27 as female parents significantly affected the two traits. Although the sweet potato germplasms conserved at the Korea Genebank represent approximately 700 accessions, the results of this study showed that a variety of female parents was lacking. In fact, the sweet potato germplasms contained in the Korea Genebank are almost all cultivars or breeding lines without their wild type relatives [35]. Since 1955, Mexico and the United States have collected many wild plants related to sweet potatoes to study sweet potato’s phylogeny and the utilization of wild plants in sweet potato breeding [36]. Wild relatives have provided breeders with genes for pest and disease resistance, abiotic stress tolerance, and quality traits [37]. The results of this study confirmed that sweet potato germplasms conserved in the Korea Genebank need a greater variety of female parents. Despite this, analysis of the genetic diversity of nuclear DNA in sweet potato germplasms should still be conducted. Additional collection and conservation of various female parents and wild relatives of sweet potatoes are very important to improve the quality of sweet potato germplasm and satisfy the demand of breeders.
Supplementary Materials
The following are available online at https://0-www-mdpi-com.brum.beds.ac.uk/2073-4395/9/11/752/s1, Table S1: List of 558 sweet potato germplasms.
Author Contributions
Conceptualization, K.J.L.; Data curation, K.J.L. and G.-A.L.; Formal analysis, K.J.L., R.S., and G.-A.L.; Investigation, J.-R.L., M.-J.S., and G.-T.C.; Project administration, D.Y.H.; Resources, J.-R.L., M.-J.S., and G.-T.C.; Writing—original draft, K.J.L.; Writing—review and editing, D.Y.H.
Funding
This study was carried out with the support of the “Research Program for Agricultural Science & Technology Development (Project No. PJ010883)”. It was also supported by the 2017 Postdoctoral Fellowship Program of the National Institute of Agricultural Sciences funded by the Rural Development Administration, Republic of Korea.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Ramanatha Rao, V.; Hodgkin, T. Genetic diversity and conservation and utilization of plant genetic resources. Plant Cell Tissue Organ Cult. 2002, 68, 1–19. [Google Scholar] [CrossRef]
- Cadima Fuentes, X.; van Treuren, R.; Hoekstra, R.; van den Berg, R.G.; Sosef, M.S.M. Genetic diversity of Bolivian wild potato germplasm: Changes during ex situ conservation management and comparisons with resampled in situ populations. Genet. Resour. Crop Evol. 2017, 64, 331–344. [Google Scholar] [CrossRef]
- Xiao, L.Q.; Ge, X.J.; Gong, X.; Hao, G.; Zheng, S.X. ISSR variation in the endemic and endangered plant Cycas guizhouensis (Cycadaceae). Ann. Bot. 2004, 94, 133–138. [Google Scholar] [CrossRef] [PubMed]
- Katayama, K.; Kobayashi, A.; Sakai, T.; Kuranouchi, T.; Kai, Y. Recent progress in sweetpotato breeding and cultivars for diverse applications in Japan. Breed. Sci. 2017, 67, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Cervantes, J.; Huamán, Z.; Carey, E.; Ghislain, M. Assessing genetic diversity of sweet potato (Ipomoea batatas (L.) Lam.) cultivars from tropical America using AFLP. Genet. Resour. Crop Evol. 2000, 47, 659–665. [Google Scholar] [CrossRef]
- Elameen, A.; Fjellheim, S.; Larsen, A.; Rognli, O.A.; Sundheim, L.; Msolla, S.; Masumba, E.; Mtunda, K.; Klemsdal, S.S. Analysis of genetic diversity in a sweet potato (Ipomoea batatas L.) germplasm collection from Tanzania as revealed by AFLP. Genet. Resour. Crop Evol. 2008, 55, 397–408. [Google Scholar] [CrossRef]
- Woolfe, J.A. Sweet Potato: An Untapped Food Resource; Cambridge University Press: Cambridge, UK; International Potato Center: Lima, Peru, 1992. [Google Scholar]
- Yang, X.S.; Su, W.J.; Wang, L.J.; Lei, J.; Chai, S.S.; Liu, Q.C. Molecular diversity and genetic structure of 380 sweetpotato accessions as revealed by SSR markers. J. Integr. Agric. 2015, 14, 633–641. [Google Scholar] [CrossRef]
- Zhang, D.; Rossel, G.; Kriegner, A.; Hijmans, R. AFLP assessment of diversity in sweetpotato from Latin America and the Pacific region: Its implications on the dispersal of the crop. Genet. Resour. Crop Evol. 2004, 51, 115–120. [Google Scholar] [CrossRef]
- Gichuki, S.T.; Berenyi, M.; Zhang, D.; Hermann, M.; Schmidt, J.; Glössl, J.; Burg, K. Genetic diversity in sweetpotato [Ipomoea batatas (L.) Lam.] in relationship to geographic sources as assessed with RAPD markers. Genet. Resour. Crop Evol. 2003, 50, 429–437. [Google Scholar] [CrossRef]
- Meng, Y.S.; Zhao, N.; Li, H.; Zhai, H.; He, S.Z.; Liu, Q.C. SSR fingerprinting of 203 sweetpotato (Ipomoea batatas (L.) Lam.) varieties. J. Integr. Agric. 2018, 17, 86–93. [Google Scholar] [CrossRef]
- Roullier, C.; Kambouo, R.; Paofa, J.; McKey, D.; Lebot, V. On the origin of sweet potato (Ipomoea batatas (L.) Lam.) genetic diversity in New Guinea, a secondary centre of diversity. Heredity 2013, 110, 594–604. [Google Scholar] [CrossRef] [PubMed]
- Roullier, C.; Rossel, G.; Tay, D.; McKey, D.; Lebot, V. Combining chloroplast and nuclear microsatellites to investigate origin and dispersal of New World sweet potato landraces. Mol. Ecol. 2011, 20, 3963–3977. [Google Scholar] [CrossRef] [PubMed]
- Moore, M.J.; Bell, C.D.; Soltis, P.S.; Soltis, D.E. Using plastid genome-scale data to resolve enigmatic relationships among basal angiosperms. Proc. Natl. Acad. Sci. USA 2007, 104, 19363–19368. [Google Scholar] [CrossRef] [PubMed]
- Pervaiz, T.; Zhang, C.; Faheem, M.; Mu, Q.; Fang, J. Chloroplast based genetic diversity among Chinese grapes genotypes. Mitochondrial DNA Part A 2017, 28, 565–569. [Google Scholar] [CrossRef]
- Provan, J.; Powell, W.; Hollingsworth, P.M. Chloroplast microsatellites: New tools for studies in plant ecology and evolution. Trends Ecol. Evol. 2001, 16, 142–147. [Google Scholar] [CrossRef]
- McCauley, D.E. The use of chloroplast DNA polymorphism in studies of gene flow in plants. Trends Ecol. Evol. 1995, 10, 198–202. [Google Scholar] [CrossRef]
- Powell, W.; Morgante, M.; Andre, C.; McNicol, J.W.; Machray, G.C.; Doyle, J.J.; Tingey, S.V.; Rafalski, J.A. Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Curr. Biol. 1995, 5, 1023–1029. [Google Scholar] [CrossRef]
- Huang, J.; Yang, X.; Zhang, C.; Yin, X.; Liu, S.; Li, X. Development of Chloroplast Microsatellite Markers and Analysis of Chloroplast Diversity in Chinese Jujube (Ziziphus jujuba Mill.) and Wild Jujube (Ziziphus acidojujuba Mill.). PLoS ONE 2015, 10, e0134519. [Google Scholar] [CrossRef]
- Kim, I.H. East Asian Nations’ Awareness on Ocean during the 16-18th Century Perceived from Transfer of Sweet Potatoes. J. Asia Pac. Stud. 2014, 21, 69–97. [Google Scholar]
- Peakall, R.; Smouse, P.E. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
- Perrier, X.; Jacquemoud-Collet, J.P. DARwin Software. Available online: http://darwin.cirad.fr/darwin (accessed on 10 October 2019).
- Kamvar, Z.N.; Tabima, J.F.; Grunwald, N.J. Poppr: An R package for genetic analysis of populations with clonal, partially clonal, and/or sexual reproduction. PeerJ 2014, 2, e281. [Google Scholar] [CrossRef]
- Bandelt, H.J.; Forster, P.; Rohl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Laurie, S.M.; Calitz, F.J.; Adebola, P.O.; Lezar, A. Characterization and evaluation of South African sweet potato (Ipomoea batatas (L.) LAM) land races. S. Afr. J. Bot. 2013, 85, 10–16. [Google Scholar] [CrossRef]
- Desiderio, F.; Bitocchi, E.; Bellucci, E.; Rau, D.; Rodriguez, M.; Attene, G.; Papa, R.; Nanni, L. Chloroplast Microsatellite Diversity in Phaseolus vulgaris. Front. Plant Sci. 2012, 3, 312. [Google Scholar] [CrossRef]
- Singh, N.; Pal, A.K.; Roy, R.K.; Tamta, S.; Rana, T.S. Development of cpSSR markers for analysis of genetic diversity in Gladiolus cultivars. Plant Gene 2017, 10, 31–36. [Google Scholar] [CrossRef]
- The International Potato Center (CIP). Global Strategy for Ex-Situ Conservation of sweetpotato Genetic Resources. Sweetpotato Genetic Resources Conservation—CIP November 2007. Available online: http://www.croptrust.org/documents/web/SweetPotato-Strategy-FINAL-12Dec07.pdf (accessed on 10 October 2019).
- Kawa, N. Tropical Root and Tuber Crops: Cassava, Sweet Potato, Yams and Aroids by V. Lebot. Econ. Bot. 2010, 64, 86–87. [Google Scholar]
- Shiga, T.; Sakamoto, S.; Ando, T.; Ishikawa, H.; Kato, S.; Takemata, T.; Umehara, M. On a new sweet potato [Ipomoea batatas] cultivar “Beniazuma”. Bull. Nat. Agric. Res. Cent. 1985, 3, 73–84. [Google Scholar]
- Katayama, K.; Tamiya, S.; Kuranouchi, T.; Komaki, K.; Nakatani, M. New sweet potato cultivar “Quick Sweet”. Bull. Natl. Inst. Crop Sci. 2003, 3, 35–52. [Google Scholar]
- Ohara-Takada, A.; Kumagai, T.; Kuranouchi, T.; Nakamura, Y.; Fujita, T.; Nakatani, M.; Tamiya, S.; Katayama, K. ‘Aikomachi’, a new sweetpotato cultivar with good appearance and high confectionery quality. Bull. Naro Inst. Crop Sci. 2016, 16, 35–55. [Google Scholar]
- RDA. Plant Germplasm Research 20; RDA: Jeonju, Korea, 2007. [Google Scholar]
- Lin, K.H.; Lai, Y.C.; Chang, K.Y.; Chen, Y.F.; Hwang, S.Y.; Lo, H.F. Improving breeding efficiency for quality and yield of sweet potato. Bot. Stud. 2007, 48, 283–292. [Google Scholar]
- Mok, I.G.; Zhao, D.; Kwak, S.S. Genetic resources of sweetpotato for industrial use. J. Plant Biotechnol. 2009, 36, 202. [Google Scholar] [CrossRef]
- Kobayashi, M.; Miyazaki, T. Sweet potato breeding using wild related species. In Proceedings of the Fourth Symposium of the International Society for Tropical Root Crops, IDRC, Cali, Colombia, 1–7 August 1976; Volume 1, pp. 53–57. [Google Scholar]
- Khoury, C.K.; Heider, B.; Castañeda-Álvarez, N.P.; Achicanoy, H.A.; Sosa, C.C.; Miller, R.E.; Scotland, R.W.; Wood, J.R.I.; Rossel, G.; Eserman, L.A.; et al. Distributions, ex situ conservation priorities, and genetic resource potential of crop wild relatives of sweetpotato [Ipomoea batatas (L.) Lam., I. series Batatas]. Front. Plant Sci. 2015, 6, 251. [Google Scholar] [CrossRef] [PubMed]
Figure 1.
Median-joining network of eight cpSSR haplotypes. Circle size is proportional to the number of accessions that carry this chloroplast haplotype.
Figure 1.
Median-joining network of eight cpSSR haplotypes. Circle size is proportional to the number of accessions that carry this chloroplast haplotype.
Figure 2.
(A) Factorial analysis of the 8 cpSSR haplotypes. H, chloroplast haplotypes based on the median-joining network. (B) Original countries of sweet potato accessions and geographic distributions of the chloroplast haplotypes found. Pie charts on the map represent the chlorotype composition of the accessions and the colors in each chart represent the chlorotype indicated by factorial analysis.
Figure 2.
(A) Factorial analysis of the 8 cpSSR haplotypes. H, chloroplast haplotypes based on the median-joining network. (B) Original countries of sweet potato accessions and geographic distributions of the chloroplast haplotypes found. Pie charts on the map represent the chlorotype composition of the accessions and the colors in each chart represent the chlorotype indicated by factorial analysis.
Table 1.
Number of sweet potato accessions in this study.
| Unknown | Breeding Line | Cultivar | Landrace | Total | |
|---|---|---|---|---|---|
| CHN 1 | 11 | 2 | 29 | 1 | 43 |
| IDN | 3 | 18 | 9 | 30 | |
| JPN | 15 | 22 | 79 | 7 | 123 |
| KOR | 125 | 48 | 17 | 190 | |
| NZE | 9 | 9 | |||
| PER | 50 | 50 | |||
| PHL | 1 | 8 | 9 | ||
| PRK | 2 | 3 | 1 | 6 | |
| TWN | 31 | 32 | 10 | 73 | |
| USA | 22 | 3 | 25 | ||
| Total | 60 | 184 | 276 | 38 | 558 |
1 CHN, China; IND, Indonesia; JPN, Japan; KOR, South Korea; NZE, New Zealand; PER, Peru; PHL, Philippines; PRK, North Korea; TWN, Taiwan; USA, United States.
Table 2.
Nine cpSSR markers used in this study.
| SSR Marker | Primer Sequences (5′→3′) | Dye |
|---|---|---|
| ccmp2 | F: GATCCCGGACGTAATCCTG | 6-FAM |
| R: ATCGTACCGAGGGTTCGAAT | ||
| NTCP18 | F: CTGTTCTTTCCATGACCCCTC | HEX |
| R: CCACCTAGCCAAGCCAGA | ||
| NTCP28 | F: TCCAATGGCTTTGGCTA | NED |
| R: AGAAACGAAGGAACCCAC | ||
| NTCP26 | F: GCAATTGCAATGGCTTCTTTA | 6-FAM |
| R: TTTATGTTCGGTGGAAATCACA | ||
| Ibcp5 | F: GCTCTCACGCTCAATTACTTA | HEX |
| R: ATGCTTAATTGACGACCTGT | ||
| Ibcp8 | F: AATAAGTACTTGGCCGTGAA | NED |
| R: CGATTCAAGTAGGCAAAGAG | ||
| Ibcp10 | F: ATATAAGGGGCCATTTTAGG | 6-FAM |
| R: ACGATAGAGGAGAAGGTTCC | ||
| ibcp4 | F: ATCCTGGACGTGAAGAATAA | HEX |
| R: GATGGCTGAGTGGACTAAAG | ||
| ibcp31 | F: AACGGATTTCTCCAATGTA | NED |
| R: ACCTCACCGTTTCAGAAGTA |
Table 3.
The genetic diversity parameters of nine cpSSR markers in 558 sweet potato germplasms.
| SSR marker | Na 1 | Ne | I | h | uh |
|---|---|---|---|---|---|
| Ibcp10 | 3 | 2.216 | 0.933 | 0.549 | 0.550 |
| Ibcp31 | 1 | monomorphic | |||
| Ibcp4 | 3 | 2.050 | 0.829 | 0.512 | 0.513 |
| Ibcp5 | 2 | 1.266 | 0.365 | 0.210 | 0.210 |
| Ibcp8 | 2 | 1.918 | 0.672 | 0.479 | 0.480 |
| NTCP18 | 2 | 1.174 | 0.280 | 0.148 | 0.148 |
| NTCP26 | 4 | 2.675 | 1.123 | 0.626 | 0.627 |
| NTCP28 | 2 | 1.812 | 0.640 | 0.448 | 0.449 |
| ccmp2 | 3 | 2.072 | 0.839 | 0.517 | 0.518 |
| Mean | 2.4 ± 0.3 | 1.798 ± 0.18 | 0.631 ± 0.12 | 0.388 ± 0.07 | 0.388 ± 0.07 |
1 Na = No. of alleles; Ne = No. of effective alleles; I = Shannon’s information index; h = Diversity; uh = unbiased diversity.
Table 4.
The genetic diversity parameters of ten origins in the 558 sweet potato germplasms using eight cpSSRs.
Table 4.
The genetic diversity parameters of ten origins in the 558 sweet potato germplasms using eight cpSSRs.
| Countries | Na 1 | Ne | I | h | uh |
|---|---|---|---|---|---|
| JPN | 2.22 ± 0.28 | 1.75 ± 0.16 | 0.61 ± 0.10 | 0.39 ± 0.06 | 0.39 ± 0.06 |
| KOR | 2.11 ± 0.20 | 1.64 ± 0.14 | 0.54 ± 0.10 | 0.35± 0.07 | 0.35 ± 0.07 |
| TWN | 2.11 ± 0.20 | 1.77 ± 0.18 | 0.56 ± 0.12 | 0.37 ± 0.08 | 0.38 ± 0.08 |
| USA | 2.11 ± 0.20 | 1.51 ± 0.08 | 0.51 ± 0.08 | 0.31 ± 0.05 | 0.33 ± 0.05 |
| CHN | 2.11 ± 0.20 | 1.45 ± 0.12 | 0.44 ± 0.10 | 0.27 ± 0.06 | 0.28 ± 0.07 |
| PHL | 1.67 ± 0.17 | 1.41 ± 0.13 | 0.36 ± 0.10 | 0.24 ± 0.07 | 0.27 ± 0.08 |
| PER | 1.89 ± 0.20 | 1.56 ± 0.16 | 0.44 ± 0.11 | 0.30 ± 0.08 | 0.30 ± 0.08 |
| PRK | 1.44 ± 0.18 | 1.25 ± 0.12 | 0.23 ± 0.09 | 0.15 ± 0.06 | 0.19 ± 0.08 |
| IDN | 1.78 ± 0.22 | 1.55 ± 0.17 | 0.42 ± 0.12 | 0.29 ± 0.08 | 0.30 ± 0.08 |
| NZE | 1.67 ± 0.24 | 1.30 ± 0.10 | 0.31 ± 0.10 | 0.19 ± 0.06 | 0.22 ± 0.07 |
| Mean | 1.91 ± 0.07 | 1.52 ± 0.04 | 0.44 ± 0.03 | 0.29 ± 0.02 | 0.30 ± 0.02 |
1 Na = No. of different alleles; Ne = No. of effective alleles; I = Shannon’s information index; h = Diversity; uh = unbiased diversity.
Table 5.
Geographical distribution of cpSSR haplotypes.
| KOR | JPN | TWN | USA | CHN | PER | IDN | PRK | PHL | NZE | |
|---|---|---|---|---|---|---|---|---|---|---|
| N 1 | 190 | 123 | 73 | 25 | 43 | 50 | 30 | 6 | 9 | 9 |
| H1 | 62 | 40 | 21 | 9 | 9 | 25 | 12 | 1 | 3 | 6 |
| H2 | 16 | 15 | 12 | 1 | 11 | 11 | 2 | 4 | ||
| H3 | 21 | 11 | 2 | 4 | 3 | |||||
| H4 | 4 | 8 | 1 | 8 | 4 | 2 | 3 | |||
| H5 | 15 | 3 | 2 | 3 | ||||||
| H6 | 5 | 11 | 2 | 2 | 1 | |||||
| H7 | 4 | 5 | 8 | 1 | ||||||
| H8 | 6 | 6 | 2 | 2 | ||||||
| H9 | 5 | 4 | 1 | 2 | ||||||
| H10 | 7 | 3 | 1 | 1 | ||||||
| H11 | 4 | 4 | 2 | |||||||
| H12 | 2 | 5 | 2 | |||||||
| H13 | 7 | 1 | ||||||||
| H14 | 2 | 3 | ||||||||
| H15 | 1 | 4 | ||||||||
| H16 | 4 | |||||||||
| H17 | 3 | |||||||||
| H18 | 1 | 1 | 1 | |||||||
| H19 | 1 | 1 | 1 | |||||||
| H20 | 3 | |||||||||
| H21 | 1 | 2 | ||||||||
| H22 | 2 | 1 | ||||||||
| H23 | 1 | 1 | ||||||||
| H24 | 1 | 1 | ||||||||
| H25 | 2 | |||||||||
| H26 | 2 | |||||||||
| H27 | 2 | |||||||||
| H28 | 2 | |||||||||
| H29 | 1 | 1 | ||||||||
| H30 | 2 | |||||||||
| H31 | 2 | |||||||||
| H32 | 1 | 1 | ||||||||
| H33 | 1 | 1 | ||||||||
| PH | 14 | 14 | 6 | 4 | 4 | 2 | ||||
| H | 41 | 31 | 22 | 5 | 13 | 12 | 5 | 8 | 3 | 10 |
| DH | 0.216 | 0.252 | 0.301 | 0.833 | 0.302 | 0.24 | 0.556 | 0.267 | 0.333 | 0.40 |
1 N, Number of accessions; PH, private chloroplast haplotype; H, number of distinct chloroplast haplotypes; DH, diversity of chloroplast haplotype.
Table 6.
Analysis of molecular variance (AMOVA) of sweet potato germplasms.
| Source of Variation | df | SS | MS | Est. Var. | % | PhiPT | Sig. | Nm |
|---|---|---|---|---|---|---|---|---|
| Whole data set | ||||||||
| Among Populations | 9 | 120.09 | 13.34 | 0.236 | 12% | 0.125 | <0.001 | 3.513 |
| Within Populations | 548 | 908.38 | 1.66 | 1.658 | 88% | |||
| Total | 557 | 1028.47 | 1.894 | 100% | ||||
| I | ||||||||
| Among Populations | 3 | 2.73 | 0.91 | 0.046 | 9% | 0.093 | <0.05 | 4.870 |
| Within Populations | 47 | 21.00 | 0.45 | 0.447 | 91% | |||
| Total | 50 | 23.73 | 0.493 | 100% | ||||
| II | ||||||||
| Among Populations | 3 | 1.94 | 0.65 | 0.051 | 13% | 0.134 | ns | 3.244 |
| Within Populations | 25 | 8.33 | 0.33 | 0.333 | 87% | |||
| Total | 28 | 10.28 | 0.385 | 100% | ||||
| III | ||||||||
| Among Populations | 9 | 42.48 | 4.72 | 0.273 | 36% | 0.361 | <0.001 | 0.885 |
| Within Populations | 156 | 75.40 | 0.48 | 0.483 | 64% | |||
| Total | 165 | 117.89 | 0.756 | 100% | ||||
| IV | ||||||||
| Among Populations | 8 | 5.96 | 0.74 | 0.015 | 4% | 0.042 | <0.05 | 11.370 |
| Within Populations | 258 | 89.72 | 0.35 | 0.348 | 96% | |||
| Total | 266 | 95.68 | 0.363 | 100% |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Lee, K.J.; Lee, G.-A.; Lee, J.-R.; Sebastin, R.; Shin, M.-J.; Cho, G.-T.; Hyun, D.Y. Genetic Diversity of Sweet Potato (Ipomoea batatas L. Lam) Germplasms Collected Worldwide Using Chloroplast SSR Markers. Agronomy 2019, 9, 752. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy9110752
AMA Style
Lee KJ, Lee G-A, Lee J-R, Sebastin R, Shin M-J, Cho G-T, Hyun DY. Genetic Diversity of Sweet Potato (Ipomoea batatas L. Lam) Germplasms Collected Worldwide Using Chloroplast SSR Markers. Agronomy. 2019; 9(11):752. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy9110752
Chicago/Turabian StyleLee, Kyung Jun, Gi-An Lee, Jung-Ro Lee, Raveendar Sebastin, Myoung-Jae Shin, Gyu-Taek Cho, and Do Yoon Hyun. 2019. "Genetic Diversity of Sweet Potato (Ipomoea batatas L. Lam) Germplasms Collected Worldwide Using Chloroplast SSR Markers" Agronomy 9, no. 11: 752. https://0-doi-org.brum.beds.ac.uk/10.3390/agronomy9110752
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
