Evidence for Microchimerism in Baboon Recipients of Pig Hearts
Abstract
:1. Introduction
2. Materials and Methods
2.1. Tissues from Transplanted Baboons
2.2. DNA and RNA Isolation
2.3. PCR Methods
2.4. Real-Time PCR Methods
2.5. Testing for PCMV/PRV; PCV3, CR Methods
3. Results
3.1. Improvement of the Detection Methods
Gen | Primer/Probe | Sequence | Location (Nucleotid Number) | Accession Number | Reference |
---|---|---|---|---|---|
PRE-1 | PRE-1 fwd | 5‘ GACTAGGAACCATGAGGTTGCG 3′ | 37–58 | GenBank Y00104 | Walker et al., 2003 [25] |
PRE-1 rev | 5′ AGCCTACACCACAGCCACAG 3′ | 61–85 | |||
PRE-1 probe | 5′ FAM-TTTGATCCCTGGCCTTGCTCAGTGG-BHQ1 3′ | 151–170 | |||
pGAPDH | pGAPDH fwd | GAT CGA GTT GGG GCT GTG ACT | 1083–1104 | GenBank NM_001206359.1 | Duvigneau et al., 2005 [31] |
pGAPDH rev | ACA TGG CCT CCA AGG AGT AAG A | 1188–1168 | |||
pGAPDH probe | HEX-CCA CCA ACC CCA GCA AGA GCA CGC-BHQ | 1114–1137 | |||
hGAPDH | hGAPDH fwd | GGCGATGCTGGCGCTGAGTAC | 3568–3587 | GenBank AF261085 | Behrendt et al., 2009 [32] |
hGAPDH rev | TGGTCCACACCCATGACGA | 3803–3783 | |||
hGAPDH probe | HEX-CTTCACCACCATGGAGAAGGCTGGG-BHQ1 | 3655–3678 | |||
PERV pol | PERV pol fwd | CGACTG CCCCAAGGG TTC AA | 3568–3587 | GenBank HM159246 | Yang et al., 2015 [28] |
PERV pol rev | TCTCTCCTG CAA ATC TGG GCC | 3803–3783 | |||
PERV pol probe | 6FAM-CACGTACTG GAG GAG GGTCAC CTG -BHQ1 | 3678–3655 |
3.2. Detection of PERV Sequences in Baboon Tissues after Transplantation
3.3. Evidence for Microchimerism
3.4. Baboon Cells in the Explanted Pig Heart
3.5. Absence of PERV Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Denner, J. Microchimerism, PERV and Xenotransplantation. Viruses 2023, 15, 190. [Google Scholar] [CrossRef]
- Bianchi, D.W.; Khosrotehrani, K.; Way, S.S.; MacKenzie, T.C.; Bajema, I.; O’donoghue, K. Forever Connected: The Lifelong Biological Consequences of Fetomaternal and Maternofetal Microchimerism. Clin. Chem. 2021, 67, 351–362. [Google Scholar] [CrossRef]
- Bianchi, D.W.; Zickwolf, G.K.; Weil, G.J.; Sylvester, S.; DeMaria, M.A. Male fetal progenitor cells persist in maternal blood for as long as 27 years postpartum. Proc. Natl. Acad. Sci. USA 1996, 93, 705–708. [Google Scholar] [CrossRef]
- Evans, P.C.; Lambert, N.; Maloney, S.; Furst, D.E.; Moore, J.M.; Nelson, J.L. Long-Term Fetal Micro-chimerism in Peripheral Blood Mononuclear Cell Subsets in Healthy Women and Women with Scleroderma. Blood 1999, 93, 2033–2037. [Google Scholar] [CrossRef]
- Chan, W.F.; Gurnot, C.; Montine, T.J.; Sonnen, J.A.; Guthrie, K.A.; Nelson, J.L. Male microchimerism in the human female brain. PLoS ONE 2012, 7, e45592. [Google Scholar] [CrossRef] [Green Version]
- Ståhlberg, A.; El-Heliebi, A.; Sedlmayr, P.; Kroneis, T. Unravelling the biological secrets of microchimerism by single-cell anal-ysis. Brief. Funct. Genom. 2018, 17, 255–264. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, A.S.; Thomson, A.W.; Shapiro, R.; Starzl, T.E. Chimerism after whole organ transplantation: Its relationship to graft rejection and tolerance induction. Curr. Opin. Nephrol. Hypertens. 1994, 3, 589–595. [Google Scholar] [CrossRef] [PubMed]
- Starzl, T.E.; Demetris, A.J.; Trucco, M.; Zeevi, A.; Ramos, H.; Terasaki, P.; Rudert, W.A.; Kocova, M.; Ricordi, C.; Ildstad, S.; et al. Chimerism and donor-specific nonreactivity 27 to 29 years after kidney allotransplantation. Transplantation 1993, 55, 1272–1276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Starzl, T.E.; Demetris, A.J.; Trucco, M.; Murase, N.; Ricordi, C.; Ildstad, S.; Ramos, H.; Todo, S.; Tzakis, A.; Fung, J.J.; et al. Cell migration and chimerism after whole-organ transplantation: The basis of graft acceptance. Hepatology 1993, 17, 1127–1152. [Google Scholar] [CrossRef] [PubMed]
- Rao, A.S.; Starzl, T.E.; Demetris, A.J.; Trucco, M.; Thomson, A.; Qian, S.; Murase, N.; Fung, J. The Two-Way Paradigm of Transplantation Immunology. Clin. Immunol. Immunopathol. 1996, 80 Pt 2, S46–S51. [Google Scholar] [CrossRef] [Green Version]
- Mazariegos, G.V.; Reyes, J.; Marino, I.R.; Demetris, A.J.; Flynn, B.; Irish, W.; McMichael, J.; Fung, J.J.; Starzl, T.E. Weaning of immunosup-pression in liver transplant recipients. Transplantation 1997, 63, 243–249. [Google Scholar] [CrossRef] [Green Version]
- Bloch, E.M.; Jackman, R.P.; Lee, T.-H.; Busch, M.P. Transfusion-Associated Microchimerism: The Hybrid Within. Transfus. Med. Rev. 2013, 27, 10–20. [Google Scholar] [CrossRef] [Green Version]
- Matsagos, S.; Verigou, E.; Kourakli, A.; Alexis, S.; Vrakas, S.; Argyropoulou, C.; Lazaris, V.; Spyropoulou, P.; Labropoulou, V.; Georgara, N.; et al. High Frequency of Post-Transfusion Microchimerism Among Multi-Transfused Beta-Thalassemic Patients. Front. Med. 2022, 9, 845490. [Google Scholar] [CrossRef] [PubMed]
- Nikbin, B.; Bonab, M.M.; Talebian, F. Microchimerism and Stem Cell Transplantation in Multiple Sclerosis. Int. Rev. Neurobiol. 2007, 79, 173–202. [Google Scholar] [CrossRef] [PubMed]
- Schechter, G.P.; Whang-Peng, J.; McFarland, W. Circulation of donor lymphocytes after blood transfusion in man. Blood 1977, 49, 651–656. [Google Scholar] [CrossRef] [Green Version]
- Denner, J.; Längin, M.; Reichart, B.; Krüger, L.; Fiebig, U.; Mokelke, M.; Radan, J.; Mayr, T.; Milusev, A.; Luther, F.; et al. Impact of porcine cytomegalovirus on long-term orthotopic cardiac xenotransplant survival. Sci. Rep. 2020, 10, 17531. [Google Scholar] [CrossRef] [PubMed]
- Paradis, K.; Langford, G.; Long, Z.; Heneine, W.; Sandstrom, P.; Switzer, W.M.; Chapman, L.E.; Lockey, C.; Onions, D.; Otto, E.; et al. Search for Cross-Species Transmission of Porcine Endogenous Retrovirus in Patients Treated with Living Pig Tissue. Science 1999, 285, 1236–1241. [Google Scholar] [CrossRef] [Green Version]
- Wynyard, S.; Garkavenko, O.; Elliot, R. Multiplex high resolution melting assay for estimation of Porcine Endogenous Retrovirus (PERV) relative gene dosage in pigs and detection of PERV infection in xenograft recipients. J. Virol. Methods 2011, 175, 95–100. [Google Scholar] [CrossRef]
- Morozov, V.A.; Wynyard, S.; Matsumoto, S.; Abalovich, A.; Denner, J.; Elliott, R. No PERV transmission during a clinical trial of pig islet cell transplantation. Virus Res. 2017, 227, 34–40. [Google Scholar] [CrossRef]
- Denner, J. Detection of cell-free pig DNA using integrated PERV sequences to monitor xenotransplant tissue damage and rejection. Xenotransplantation 2021, 28, e12688. [Google Scholar] [CrossRef]
- Singer, D.S.; Parent, L.; Ehrlich, R. Identification and DNA sequence of an interspersed repetitive DNA element in the genome of the miniature swine. Nucleic Acids Res. 1987, 15, 2780. [Google Scholar] [CrossRef] [PubMed]
- Ellegren, H. Variable SINE 3′ poly(A) sequences: An abundant class of genetic markers in the pig genome. Mamm. Genome 1993, 4, 429–434. [Google Scholar] [CrossRef] [PubMed]
- Yasue, H.; Takahashi, H.; Awata, T.; Popescu, P.C. Uneven-distribution of short interspersed repetitive sequence, PRE-1, on swine chromosomes. Cell Struct. Funct. 1991, 16, 475–479. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Wang, D.; Han, Y.; Duan, F.; Lv, Q.; Li, Z. Altered imprinted gene expression and methylation patterns in mid-gestation aborted cloned porcine fetuses and placentas. J. Assist. Reprod. Genet. 2014, 31, 1511–1517. [Google Scholar] [CrossRef] [Green Version]
- Walker, J.A.; Hughes, D.A.; Anders, B.A.; Shewale, J.; Sinha, S.K.; Batzer, M.A. Quantitative intra-short interspersed element PCR for species-specific DNA identification. Anal. Biochem. 2003, 316, 259–269. [Google Scholar] [CrossRef]
- Längin, M.; Mayr, T.; Reichart, B.; Michel, S.; Buchholz, S.; Guethoff, S.; Dashkevich, A.; Baehr, A.; Egerer, S.; Bauer, A.; et al. Consistent success in life-supporting porcine cardiac xenotransplantation. Nature 2018, 564, 430–433. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.M.; Singh, A.K.; Corcoran, P.C.; Thomas Iii, M.L.; Clark, T.; Lewis, B.G.; Hoyt, R.F.; Eckhaus, M.; Pierson Iii, R.N.; Belli, A.J.; et al. Chimeric 2C10R4 anti-CD40 antibody therapy is critical for long-term survival of GTKO.hCD46.hTBM pig-to-primate cardiac xenograft. Nat. Commun. 2016, 7, 11138. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Güell, M.; Niu, D.; George, H.; Lesha, E.; Grishin, D.; Aach, J.; Shrock, E.; Xu, W.; Poci, J.; et al. Genome-wide inactivation of porcine endogenous retroviruses (PERVs). Science 2015, 350, 1101–1104. [Google Scholar] [CrossRef] [Green Version]
- Krüger, L.; Längin, M.; Reichart, B.; Fiebig, U.; Kristiansen, Y.; Prinz, C.; Kessler, B.; Egerer, S.; Wolf, E.; Abicht, J.-M.; et al. Transmission of Porcine Circovirus 3 (PCV3) by Xenotransplantation of Pig Hearts into Baboons. Viruses 2019, 11, 650. [Google Scholar] [CrossRef] [Green Version]
- Halecker, S.; Metzger, J.; Strube, C.; Krabben, L.; Kaufer, B.; Denner, J. Virological and Parasitological Characterization of Mini-LEWE Minipigs Using Improved Screening Methods and an Overview of Data on Various Minipig Breeds. Microorganisms 2021, 9, 2617. [Google Scholar] [CrossRef]
- Duvigneau, J.C.; Hartl, R.T.; Groiss, S.; Gemeiner, M. Quantitative simultaneous multiplex real-time PCR for the detection of porcine cytokines. J. Immunol. Methods 2005, 306, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Behrendt, R.; Fiebig, U.; Norley, S.; Gürtler, L.; Kurth, R.; Denner, J. A neutralization assay for HIV-2 based on measurement of provirus integration by duplex real-time PCR. J. Virol. Methods 2009, 159, 40–46. [Google Scholar] [CrossRef] [PubMed]
- Fiebig, U.; Fischer, K.; Bähr, A.; Runge, C.; Schnieke, A.; Wolf, E.; Denner, J. Porcine endogenous retroviruses: Quantification of the copy number in cell lines, pig breeds, and organs. Xenotransplantation 2018, 25, e12445. [Google Scholar] [CrossRef]
- Fiebig, U.; Abicht, J.-M.; Mayr, T.; Längin, M.; Bähr, A.; Guethoff, S.; Falkenau, A.; Wolf, E.; Reichart, B.; Shibahara, T.; et al. Distribution of Porcine Cytomegalovirus in Infected Donor Pigs and in Baboon Recipients of Pig Heart Transplantation. Viruses 2018, 10, 66. [Google Scholar] [CrossRef] [Green Version]
- Tucker, A.W.; Galbraith, D.; McEwan, P.; Onions, D. Evaluation of porcine cytomegalovirus as a potential zoonotic agent in Xenotransplantation. Transplant. Proc. 1999, 31, 915. [Google Scholar] [CrossRef]
- Heo, Y.; Cho, Y.; Oh, K.B.; Park, K.H.; Cho, H.; Choi, H.; Kim, M.; Yun, I.J.; Lee, H.J.; Kim, Y.B. Detection of Pig Cells Harboring Porcine Endogenous Retroviruses in Non-Human Primate Bladder After Renal Xenotransplantation. Viruses 2019, 11, 801. [Google Scholar] [CrossRef] [Green Version]
- Schochetman, G.; Epstein, J.S.; Zuck, T.F. Serodiagnosis of infection with the AIDS virus and other human retroviruses. Annu. Rev. Microbiol. 1989, 43, 629–659. [Google Scholar] [CrossRef]
- Westman, M.E.; Coggins, S.J.; van Dorsselaer, M.; Norris, J.M.; Squires, R.A.; Thompson, M.; Malik, R. Feline immunodeficiency virus (FIV) infection in domestic pet cats in Australia and New Zealand: Guidelines for diagnosis, prevention and management. Aust. Vet. J. 2022, 100, 345–359. [Google Scholar] [CrossRef]
- Evermann, J.F.; Jackson, M.K. Laboratory Diagnostic Tests for Retroviral Infections in Dairy and Beef Cattle. Vet. Clin. N. Am. Food Anim. Pract. 1997, 13, 87–106. [Google Scholar] [CrossRef]
- Mammerickx, M.; Portetelle, D.; Burny, A. The diagnosis of enzootic bovine leukosis. Comp. Immunol. Microbiol. Infect. Dis. 1985, 8, 305–309. [Google Scholar] [CrossRef]
- Kalogianni, A.I.; Stavropoulos, I.; Chaintoutis, S.C.; Bossis, I.; Gelasakis, A.I. Serological, Molecular and Culture-Based Diagnosis of Lentiviral Infections in Small Ruminants. Viruses 2021, 13, 1711. [Google Scholar] [CrossRef]
- Galbraith, D.N.; Kelly, H.T.; Dyke, A.; Reid, G.; Haworth, C.; Beekman, J.; Shepherd, A.; Smith, K.T. Design and validation of immuno-logical tests for the detection of Porcine endogenous retrovirus in biological materials. J. Virol. Methods. 2000, 90, 115–124. [Google Scholar] [CrossRef]
- Matthews, A.L.; Brown, J.; Switzer, W.; Folks, T.M.; Heneine, W.; Sandstrom, P.A. Development and validation of a western immunoblot assay for detection of antibodies to porcine endogenous retrovirus1. Transplantation 1999, 67, 939–943. [Google Scholar] [CrossRef]
- Tacke, S.J.; Bodusch, K.; Berg, A.; Denner, J. Sensitive and specific immunological detection methods for porcine endogenous ret-roviruses applicable to experimental and clinical xenotransplantation. Xenotransplantation 2001, 8, 125–135. [Google Scholar] [CrossRef]
- Denner, J.; Tönjes, R.R. Infection Barriers to Successful Xenotransplantation Focusing on Porcine Endogenous Retroviruses. Clin. Microbiol. Rev. 2012, 25, 318–343. [Google Scholar] [CrossRef] [Green Version]
- Denner, J. Why was PERV not transmitted during preclinical and clinical xenotransplantation trials and after inoculation of animals? Retrovirology 2018, 15, 28. [Google Scholar] [CrossRef] [Green Version]
- Argaw, T.; Colon-Moran, W.; Wilson, C.A. Limited infection without evidence of replication by porcine endogenous retrovirus in guinea pigs. J. Gen. Virol. 2004, 85 Pt 1, 15–19. [Google Scholar] [CrossRef]
- Lopez, A.; Mariette, X.; Bachelez, H.; Belot, A.; Bonnotte, B.; Hachulla, E.; Lahfa, M.; Lortholary, O.; Loulergue, P.; Paul, S.; et al. Vaccination recommendations for the adult immunosuppressed patient: A systematic review and comprehensive field synopsis. J. Autoimmun. 2017, 80, 10–27. [Google Scholar] [CrossRef]
- Giannella, M.; Righi, E.; Pascale, R.; Rinaldi, M.; Caroccia, N.; Gamberini, C.; Palacios-Baena, Z.R.; Caponcello, G.; Morelli, M.C.; Tamè, M.; et al. Evaluation of the Kinetics of Antibody Re-sponse to COVID-19 Vaccine in Solid Organ Transplant Recipients: The Prospective Multicenter ORCHESTRA Cohort. Microorganisms 2022, 10, 1021. [Google Scholar] [CrossRef]
- Danziger-Isakov, L.; Kumar, D.; AST Infectious Diseases Community of Practice. Vaccination in solid organ transplantation. Am. J. Transplant. 2013, 13 (Suppl. 4), 311–317. [Google Scholar] [CrossRef]
- Pittet, L.F.; Posfay-Barbe, K.M. Immunization in transplantation: Review of the recent literature. Curr. Opin. Organ Transplant. 2013, 18, 543–548. [Google Scholar] [CrossRef]
Animal Number | Animal Recipient ID | Donor Genetics | Time of Sampling [POD] | Blood Group of the Donor | Blood Group of the Recipient | Study Design |
---|---|---|---|---|---|---|
A | 17475 | GT-KO/hCD46/hTM | 195 | 0 | AB | oHTx |
B | 17493 | GT-KO/hCD46/hTM | 194 | 0 | B | oHTx |
C | 17492 | GT-KO/hCD46/hTM | 26 | 0 | B | oHTx |
D | 17769 | GT-KO/hCD46/hTM | 50 | 0 | B | oHTx |
Tissue/ Real-Time PCR | Ct Values | |||||
---|---|---|---|---|---|---|
PCMV/PRV | PCV3 | PERV Pol | pGAPDH | PRE-1 | hGAPDH | |
Skin | N. d. | N.d. | 29. 81 | N.d. | 22.51 | 20.00 |
Kidney | N.d. | N.d. | 31.72 | N.d. | 24.65 | 18.23 |
Spleen | N.d. | N.d. | 32.05 | N.d. | 19.55 | 17.2 |
Liver | N.d. | N.d. | N.d. | N.d. | 20.64 | 17.74 |
Lung | N.d. | N.d. | 32.47 | N.d. | 18.72 | 18.07 |
Aorta | N.d. | N.d. | 21.91 | 27.49 | 16.4 | 20.89 |
Pericardium | N.d. | N.d. | 22.83 | 25.69 | Not available | 20.22 |
Left ventricle | N.d. | N.d. | 14.17 | 17.76 | 6.54 | 18.68 |
Baboon | B | C | D | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Tissue/Real-Time PCR | Ct Values | |||||||||||
PERV Pol | pGAPDH | PRE-1 | hGAPDH | PERV Pol | pGAPDH | PRE-1 | hGAPDH | PERV Pol | pGAPDH | PRE-1 | hGAPDH | |
Kidney | N.d. | N.d. | 19.57 | 18.02 | N.d. | N.d. | 22.25 | 17.89 | N.d. | N.d. | 22.36 | 19.16 |
Spleen | N.d. | N.d. | 20.73 | 18.34 | N.d. | N.d. | 19.93 | 18.53 | N.d. | N.d. | 21.84 | 19.16 |
Liver | 27.76 | N.d. | 20.33 | 20.97 | 32.54 | N.d. | 20.06 | 18.94 | N.d. | N.d. | 22.34 | 19.88 |
Lung | 27.49 | N.d. | 17.51 | 17.56 | 32.81 | N.d. | 19.86 | 18.92 | N.d. | N.d. | 20.25 | 18.83 |
Aorta | 24.62 | 28.65 | 15.07 | 18.29 | N.d. | N.d. | 23.17 | 19.30 | N.d. | N.d. | 24.23 | 20.51 |
Pericardium | 25.40 | 30.16 | 16.47 | 19.36 | 23.29 | 26.85 | 14.11 | 19.23 | 25.16 | 28.9 | 16.13 | 23.23 |
Tissue/ Real-Time PCR | Ct Values | |
---|---|---|
PERV Pol | hGAPDH | |
Kidney | N. d. | 23.54 |
Lung | N.d. | 25.24 |
Spleen | N.d | 21.36 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jhelum, H.; Bender, M.; Reichart, B.; Mokelke, M.; Radan, J.; Neumann, E.; Krabben, L.; Abicht, J.-M.; Kaufer, B.; Längin, M.; et al. Evidence for Microchimerism in Baboon Recipients of Pig Hearts. Viruses 2023, 15, 1618. https://0-doi-org.brum.beds.ac.uk/10.3390/v15071618
Jhelum H, Bender M, Reichart B, Mokelke M, Radan J, Neumann E, Krabben L, Abicht J-M, Kaufer B, Längin M, et al. Evidence for Microchimerism in Baboon Recipients of Pig Hearts. Viruses. 2023; 15(7):1618. https://0-doi-org.brum.beds.ac.uk/10.3390/v15071618
Chicago/Turabian StyleJhelum, Hina, Martin Bender, Bruno Reichart, Maren Mokelke, Julia Radan, Elisabeth Neumann, Ludwig Krabben, Jan-Michael Abicht, Benedikt Kaufer, Matthias Längin, and et al. 2023. "Evidence for Microchimerism in Baboon Recipients of Pig Hearts" Viruses 15, no. 7: 1618. https://0-doi-org.brum.beds.ac.uk/10.3390/v15071618