Characterization and Tissue Tropism of Newly Identified Iflavirus and Negeviruses in Glossina morsitans morsitans Tsetse Flies
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection/Experimental Flies and Procedures
2.2. Discovery of RNA Virus Sequences and Genome Annotation
2.3. RNA Extraction and cDNA Synthesis
2.4. Virus Detection by RT-PCR
2.5. Sequencing and Phylogenetic Analysis
2.6. Detection of Replicative RNA Strand by RT-PCR
2.7. Tissue Distribution of Iflavirus and Negevirus Infection in Adult Tsetse Flies
2.7.1. Relative Expression of Iflavirus and Negevirus in Adult Tsetse Tissues Using RT-qPCR
2.7.2. Detection of Iflavirus and Negevirus in Adult Tsetse Tissues Using FISH
2.8. Statistical Analyses
3. Results
3.1. Discovery of the RNA Viruses in G. m. morsitans
3.2. Viral RNA Genome Analysis and Organization
3.3. Phylogenetic Analysis
3.4. Detection of Replicative RNA Forms of Iflavirus and Negevirus in G. m. morsitans
3.5. Tissue Distribution of Iflavirus and Negevirus Infection
3.5.1. Assessment of Iflavirus and Negevirus Density in Different Tsetse Tissues by RT-qPCR
3.5.2. Stellaris FISH
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Krafsur, E.S. Tsetse Flies: Genetics, Evolution and Role as Vectors. Infect. Genet. Evol. 2009, 9, 124–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abd-Alla, A.M.M.; Cousserans, F.; Parker, A.G.; Jehle, J.A.; Parker, N.J.; Vlak, J.M.; Robinson, A.S.; Bergoin, M. Genome Analysis of a Glossina Pallidipes Salivary Gland Hypertrophy Virus (GpSGHV) Reveals a Novel Large Double-Stranded Circular DNA Virus. J. Virol. 2008, 82, 4595–4611. [Google Scholar] [CrossRef] [Green Version]
- Abd-Alla, A.M.M.; Parker, A.G.; Vreysen, M.J.B.; Bergoin, M. Tsetse Salivary Gland Hypertrophy Virus: Hope or Hindrance for Tsetse Control? PLoS Negl. Trop. Dis. 2011, 5, e1220. [Google Scholar] [CrossRef]
- Abd-Alla, A.M.M.; Kariithi, H.M.; Parker, A.G.; Robinson, A.S.; Kiflom, M.; Bergoin, M.; Vreysen, M.J.B. Dynamics of the Salivary Gland Hypertrophy Virus in Laboratory Colonies of Glossina Pallidipes (Diptera: Glossinidae). Virus Res. 2010, 150, 103–110. [Google Scholar] [CrossRef]
- Robinson, A.S. Mutations and Their Use in Insect Control. Mutat. Res. 2002, 511, 113–132. [Google Scholar] [CrossRef]
- Robinson, A.S. Genetic Basis of the Sterile Insect Technique. In The Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management; Dyck, V.A., Hendrichs, J., Robinson, A.S., Eds.; Springer: Dordrecht, The Netherlands, 2005; pp. 95–114. ISBN 1-4020-4050-4. [Google Scholar]
- Boucias, D.G.; Kariithi, H.M.; Bourtzis, K.; Schneider, D.I.; Kelley, K.; Miller, W.J.; Parker, A.G.; Abd-Alla, A.M.M. Transgenerational Transmission of the Glossina Pallidipes Hytrosavirus Depends on the Presence of a Functional Symbiome. PLoS ONE 2013, 8, e61150. [Google Scholar] [CrossRef] [PubMed]
- Doudoumis, V.; Blow, F.; Saridaki, A.; Augustinos, A.A.; Dyer, N.A.; Goodhead, I.B.; Solano, P.; Rayaisse, J.-B.; Takac, P.; Mekonnen, S.; et al. Challenging the Wigglesworthia, Sodalis, Wolbachia Symbiosis Dogma in Tsetse Flies: Spiroplasma Is Present in Both Laboratory and Natural Populations. Sci. Rep. 2017, 7, 4699. [Google Scholar] [CrossRef] [Green Version]
- O’Neill, S.L.; Gooding, R.H.; Aksoy, S. Phylogenetically Distant Symbiotic Microorganisms Reside in Glossina Midgut and Ovary Tissues. Med. Vet. Entomol. 1993, 7, 377–383. [Google Scholar] [CrossRef]
- Pais, R.; Lohs, C.; Wu, Y.; Wang, J.W.; Aksoy, S. The Obligate Mutualist Wigglesworthia Glossinidia Influences Reproduction, Digestion, and Immunity Processes of Its Host, the Tsetse Fly. Appl. Environ. Microbiol. 2008, 74, 5965–5974. [Google Scholar] [CrossRef] [Green Version]
- Snyder, A.K.; Deberry, J.W.; Runyen-Janecky, L.; Rio, R.V.M. Nutrient Provisioning Facilitates Homeostasis between Tsetse Fly (Diptera: Glossinidae) Symbionts. Proc. R. Soc. B Biol. Sci. 2010, 277, 2389–2397. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.W.; Wu, Y.N.; Yang, G.X.; Aksoy, S. Interactions between Mutualist Wigglesworthia and Tsetse Peptidoglycan Recognition Protein (PGRP-LB) Influence Trypanosome Transmission. Proc. Natl. Acad. Sci. USA 2009, 106, 12133–12138. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Oers, M.M. Genomics and Biology of Iflaviruses. In Insect Virology; Asgari, S., Johnson, K.N., Eds.; Caister Academic Press: Norfolk, UK, 2010; pp. 231–250. ISBN 978-1-904455-71-4. [Google Scholar]
- Vasilakis, N.; Forrester, N.L.; Palacios, G.; Nasar, F.; Savji, N.; Rossi, S.L.; Guzman, H.; Wood, T.G.; Popov, V.; Gorchakov, R.; et al. Negevirus: A Proposed New Taxon of Insect-Specific Viruses with Wide Geographic Distribution. J. Virol. 2013, 87, 14. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, J.; Zhang, J.; Wang, X.; Jiang, H.; Liu, C.; Hu, Y. In Vitro and in Vivo Identification of Structural and Sequence Elements in the 5’ Untranslated Region of Ectropis Obliqua Picorna-like Virus Required for Internal Initiation. J. Gen. Virol. 2006, 87, 3667–3677. [Google Scholar] [CrossRef]
- Ongus, J.R.; Roode, E.C.; Pleij, C.W.A.; Vlak, J.M.; van Oers, M.M. The 59 Non-Translated Region of Varroa Destructor Virus 1 (Genus Iflavirus): Structure Prediction and IRES Activity in Lymantria Dispar Cells. J. Gen. Virol. 2006, 87, 3397–3407. [Google Scholar] [CrossRef] [PubMed]
- Nunes, M.R.T.; Contreras-Gutierrez, M.A.; Guzman, H.; Martins, L.C.; Barbirato, M.F.; Savit, C.; Balta, V.; Uribe, S.; Vivero, R.; Suaza, J.D.; et al. Genetic Characterization, Molecular Epidemiology, and Phylogenetic Relationships of Insect-Specific Viruses in the Taxon Negevirus. Virology 2017, 504, 152–167. [Google Scholar] [CrossRef]
- Kallies, R.; Kopp, A.; Zirkel, F.; Estrada, A.; Gillespie, T.R.; Drosten, C.; Junglen, S. Genetic Characterization of Goutanap Virus, a Novel Virus Related to Negeviruses, Cileviruses and Higreviruses. Viruses 2014, 6, 4346–4357. [Google Scholar] [CrossRef]
- Carapeta, S.; do Bem, B.; McGuinness, J.; Esteves, A.; Abecasis, A.; Lopes, Â.; de Matos, A.P.; Piedade, J.; de Almeida, A.P.G.; Parreira, R. Negeviruses Found in Multiple Species of Mosquitoes from Southern Portugal: Isolation, Genetic Diversity, and Replication in Insect Cell Culture. Virology 2015, 483, 318–328. [Google Scholar] [CrossRef] [Green Version]
- Lorenz, R.; Bernhart, S.H.; Zu Siederdissen, C.H.; Tafer, H.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. ViennaRNA Package 2.0. Algorithms Mol. Biol. 2011, 6, 26. [Google Scholar] [CrossRef]
- Zuker, M. Mfold Web Server for Nucleic Acid Folding and Hybridization Prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Hall, T. BioEdit: An Important Software for Molecular Biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Green Version]
- Schneider, D.I.; Parker, A.G.; Abd-Alla, A.M.; Miller, W.J. High-Sensitivity Detection of Cryptic Wolbachia in the African Tsetse Fly (Glossina Spp.). BMC Microbiol. 2018, 18, 140. [Google Scholar] [CrossRef]
- Heddi, A.; Grenier, A.M.; Khatchadourian, C.; Charles, H.; Nardon, P. Four Intracellular Genomes Direct Weevil Biology: Nuclear, Mitochondrial, Principal Endosymbiont, and Wolbachia. Proc. Natl. Acad. Sci. USA 1999, 96, 6814–6819. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021. [Google Scholar]
- Baier, T.; Neuwirth, E. Excel: COM: R. Comput. Stat. 2007, 22, 91–108. [Google Scholar] [CrossRef]
- RStudio Team. RStudio: Integrated Development Environment for R; RStudio, Inc.: Boston, MA, USA, 2016. [Google Scholar]
- Wickham, H. Ggplot2: Elegant Graphics for Data Analysis; Springer: New York, NY, USA, 2016; ISBN 978-3-319-24277-4. [Google Scholar]
- Sarkar, D. Lattice: Multivariate Data Visualization with R; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2008. [Google Scholar]
- Fox, J.; Weisberg, S. An R Companion to Applied Regression, 3rd ed.; Sage: Thousand Oaks, CA, USA, 2019. [Google Scholar]
- Jeffrey, B. Arnold Ggthemes: Extra Themes, Scales and Geoms for “Ggplot2”, R Package Version 4.2.4; 2021. Available online: https://github.com/jrnold/ggthemes (accessed on 27 May 2020).
- Venables, W.N.; Ripley, B.D. Modern Applied Statistics with S, 4th ed.; Springer: New York, NY, USA, 2002. [Google Scholar]
- Shi, M.; Lin, X.-D.; Tian, F.-H.; Chen, L.-J.; Chen, X.; Li, C.-X.; Qin, X.-C.; Li, J.; Cao, J.-P.; Eden, J.-S.; et al. Redefining the Invertebrate RNA Virosphere. Nature 2016, 540, 539–543. [Google Scholar] [CrossRef]
- Witwer, C.; Rauscher, S.; Hofacker, I.L.; Stadler, P.F. Conserved RNA Secondary Structures in Picornaviridae Genomes. Nucleic Acids Res. 2001, 29, 5079–5089. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.-Y.; Wu, C.-Y.; Chen, Y.-J.; Chen, C.-Y.; Wang, C.-H. The 5′ Untranslated Region of Perina Nuda Virus (PnV) Possesses a Strong Internal Translation Activity in Baculovirus-infected Insect Cells. FEBS Lett. 2007, 581, 3120–3126. [Google Scholar] [CrossRef] [Green Version]
- Abbasi, I.; Trancoso Lopo de Queiroz, A.; Kirstein, O.D.; Nasereddin, A.; Horwitz, B.Z.; Hailu, A.; Salah, I.; Mota, T.F.; Fraga, D.B.M.; Veras, P.S.T.; et al. Plant-Feeding Phlebotomine Sand Flies, Vectors of Leishmaniasis, Prefer Cannabis Sativa. Proc. Natl. Acad. Sci. USA 2018, 115, 11790–11795. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kenney, A.; Cusick, A.; Payne, J.; Gaughenbaugh, A.; Renshaw, A.; Wright, J.; Seeber, R.; Barnes, R.; Florjanczyk, A.; Horzempa, J. The Potential for Flower Nectar to Allow Mosquito to Mosquito Transmission of Francisella Tularensis. PLoS ONE 2017, 12, e0175157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Solano, P.; Salou, E.; Rayaisse, J.B.; Ravel, S.; Gimonneau, G.; Traore, I.; Bouyer, J. Do Tsetse Flies Only Feed on Blood? Infect. Genet. Evol. 2015, 36, 184–189. [Google Scholar] [CrossRef] [Green Version]
- Jakubowska, A.K.; Murillo, R.; Carballo, A.; Williams, T.; van Lent, J.W.M.; Caballero, P.; Herrero, S. Iflavirus Increases Its Infectivity and Physical Stability in Association with Baculovirus. PeerJ 2016, 4, e1687. [Google Scholar] [CrossRef] [Green Version]
- Kariithi, H.M.; Boucias, D.G.; Murungi, E.K.; Meki, I.K.; Demirbaş-Uzel, G.; van Oers, M.M.; Vreysen, M.J.; Abd-Alla, A.M.; Vlak, J.M. Coevolution of Hytrosaviruses and Host Immune Responses. BMC Microbiol. 2018, 18, 183. [Google Scholar] [CrossRef] [PubMed]
- Tantillo, G.; Bottaro, M.; Di Pinto, A.; Martella, V.; Di Pinto, P.; Terio, V. Virus Infections of Honeybees Apis Mellifera. Ital. J. Food Saf. 2015, 4, 5364. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Demirbas-Uzel, G.; Kariithi, H.M.; Parker, A.G.; Vreysen, M.J.B.; Mach, R.L.; Abd-Alla, A.M.M. Susceptibility of Tsetse Species to Glossina Pallidipes Salivary Gland Hypertrophy Virus (GpSGHV). Front. Microbiol. 2018, 9, 701. [Google Scholar] [CrossRef] [Green Version]
- Manokaran, G.; Flores, H.A.; Dickson, C.T.; Narayana, V.K.; Kanojia, K.; Dayalan, S.; Tull, D.; McConville, M.J.; Mackenzie, J.M.; Simmons, C.P. Modulation of Acyl-Carnitines, the Broad Mechanism behind Wolbachia-Mediated Inhibition of Medically Important Flaviviruses in Aedes aegypti. Proc. Natl. Acad. Sci. USA 2020, 117, 24475–24483. [Google Scholar] [CrossRef] [PubMed]
Primers for GmmIV 5′ RACE | |
IflaTse_SP3 | ATAGATGCAGGATGGTTAGGTTGCT |
IflaTse_SP2 | GAGCCTGATGGATGTTGTGTTTGT |
IflaTse_SP1 | ACACCATACTTACACACAGCCATTC |
Primers for GmmIV detection | |
Iflav-tseCont1-1R | AAATGGCTACGCGATGTAGAATGG |
Iflav-tseCont1-1F | TTTGCCTTTGTCCTTTAGATGTGCT |
IflaTse_C1-F1 | TGTTGGTGCTAGATTTAAGGAAAGGT |
IflaTse_C1-F2 | TTGAATTAGTTAAGCGATCTAGCCA |
IflaTse_C83-R1 | TCGGACATAGAATCAACAACAATACCA |
IflaTse_C83-R2 | AAGAACACTTCAATCTCTCTGCCAA |
Primers to join the GmmIV contigs | |
Iflav-tseCont83-1F | ATAGCCCCTAAAACAATAGCCCAAA |
Iflav-tseCont83-1R | CCACACATTCCTCTACCATTTACTT |
Iflav-tseCont83-2F | CAGGTATGGTTAGTGGTGAGAGAGG |
Iflav-tseCont83-2R | GGACGAACAGAGGAAAACGGAAAAC |
Primers for GmmIV 3′ RACE | |
IflaTse_C83-F3-a | GCAATGGATAAGCGTGCAATAGAAG |
IflaTse_C83-F3-b | TTTGGCGTAAAGAACGATTGGTG |
Primers for GmmNegeV 5′ RACE | |
NegeTse_SP3 | TATGTAGCAATTTCGTTGAGAG |
NegeTse_SP2 | TTTACAGCATCAGCAGAATCCA |
NegeTse_SP1 | TGGAACGACAAGACGAATAGG |
Primers for GmmNegeV detection | |
NegeTse_C215-1F | TGTCTTGGTTTAGGAGTTTATTCGATGG |
Negv-tseCont1351-1F | CCATTGTACTGAATTGCGTCCTAAGT |
Primers to join GmmNegeV contigs | |
NegeTse_C1351-1R | GTACGGATGAATCGCAAATAAATGA |
Negv-tseCont1351-1R | CATAACGGCAGCGTCACTCATAAC |
NegeTse_C1351-1F | CGGTAACGCTGTTGTTAAATCTT |
NegeTse_C2539-1R | TTCATGTCAGCAACTCTAACAAATC |
NegeTse_C2539-1F | CTTGTGACGTGGTCGCTGCTTT |
NegeTse_C1602-1R | ACATACGCCTGTTGCGGATA |
Negv-tseCont1602-1F | CTTCGTGTCCTAATGTTCGTTTTGT |
Negv-tseCont1602-1R | GTTTTCCGTATTTTCTGTAAGCGTG |
NegeTse_C1602-3F-a | AGCAAGGTGGATGGGTATATCTTGT |
NegeTse_C1602-3F-b | TGATAAAGAACCTGTGTATGTTCCC |
NegeTse_C1602-2R | TCTAAAGAAGGAAAGTCAGGGTTAC |
Primers for GmmNegeV 3′ RACE | |
NegeTse_C1602-2F-a | TATCCGAAGGTTATGGTTATGGTT |
NegeTse_C1602-2F-b | TTTCCTCCTTCGTCTTATGTGA |
NegeTse_C1602-3R | TAGTCACATAAGACGAAGGAGGA |
Primers for GmmIV and GmmNegeV RT-qPCR | |
Ifla_qPCR2_7848F | AGAAATTGAAGGACAGATGTTTGGT |
Ifla_qPCR2_7947R | ACCTAAGAAATTACCAGTACCCTCC |
Nege_qPCR1-2411F | CAACATAGACTTGAACCAGAGCA |
Nege_qPCR1-2529R | GAAACATCAAACACACTCCCATTAG |
Tsetse-tubulinF | GATGGTCAAGTGCGATCCT |
Tsetse-tubulinR | TGAGAACTCGCCTTCTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meki, I.K.; Huditz, H.-I.; Strunov, A.; van der Vlugt, R.A.A.; Kariithi, H.M.; Rezapanah, M.; Miller, W.J.; Vlak, J.M.; van Oers, M.M.; Abd-Alla, A.M.M. Characterization and Tissue Tropism of Newly Identified Iflavirus and Negeviruses in Glossina morsitans morsitans Tsetse Flies. Viruses 2021, 13, 2472. https://0-doi-org.brum.beds.ac.uk/10.3390/v13122472
Meki IK, Huditz H-I, Strunov A, van der Vlugt RAA, Kariithi HM, Rezapanah M, Miller WJ, Vlak JM, van Oers MM, Abd-Alla AMM. Characterization and Tissue Tropism of Newly Identified Iflavirus and Negeviruses in Glossina morsitans morsitans Tsetse Flies. Viruses. 2021; 13(12):2472. https://0-doi-org.brum.beds.ac.uk/10.3390/v13122472
Chicago/Turabian StyleMeki, Irene K., Hannah-Isadora Huditz, Anton Strunov, René A. A. van der Vlugt, Henry M. Kariithi, Mohammadreza Rezapanah, Wolfgang J. Miller, Just M. Vlak, Monique M. van Oers, and Adly M. M. Abd-Alla. 2021. "Characterization and Tissue Tropism of Newly Identified Iflavirus and Negeviruses in Glossina morsitans morsitans Tsetse Flies" Viruses 13, no. 12: 2472. https://0-doi-org.brum.beds.ac.uk/10.3390/v13122472