Green Synthesized Chitosan Nanoparticles for Controlling Multidrug-Resistant mecA- and blaZ-Positive Staphylococcus aureus and aadA1-Positive Escherichia coli
Abstract
:1. Introduction
2. Results
2.1. Green Synthesis of Chitosan Nanoparticles (ChiNPs)
2.2. UV–Vis Spectroscopic Analysis to Determine Particle Yield
2.3. NP Analyses Using DLS and XRD
2.4. Step-by-Step Confirmation of ChiNPs Synthesis Using FTIR
2.5. Morphological Investigation with AFM
2.6. Surface Topographic Analysis Using SEM
2.7. ChiNPs Analysis Using TEM
2.8. Identification and Characterization of MDR Bacteria
2.9. Determination of the Antibacterial Activity of ChiNP
2.10. Biosafety Evaluation of ChiNPs
3. Materials and Methods
3.1. Materials
3.2. Preparation of Chitosan Solution and Lemon Extract
3.3. Synthesis of Chitosan Nanoparticles (ChiNPs)
3.4. Physical Characterizations of the ChiNPs
3.5. Isolation and Identification of MDR Bacteria
3.6. Determination of the Antibacterial Activity of ChiNPs
3.7. Determination of Minimum Inhibitory Concentration and Minimum Bactericidal Concentration
3.8. Evaluation of the Safety of the Synthesized ChiNPs
3.9. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kafi, M.A.; Aktar, K.; Todo, M.; Dahiya, R. Engineered chitosan for improved 3D tissue growth through Paxillin-FAK-ERK activation. Regen. Biomater. 2020, 7, 141–151. [Google Scholar] [CrossRef] [PubMed]
- Morshdy, A.E.M.; Abdallah, K.M.; Abdallah, H.E.; Algahtani, F.D.; Elabbasy, M.T.; Atique, S.; Ahmad, K.; Al-Najjar, M.A.; Abdallah, H.M.; Mahmoud, A.F.A. Potential of Natural Phenolic Compounds as Antimicrobial Agents against Multidrug-Resistant Staphylococcus aureus in Chicken Meat. Molecules 2023, 28, 6742. [Google Scholar] [CrossRef] [PubMed]
- Lubna; Hussain, T.; Shami, A.; Rafiq, N.; Khan, S.; Kabir, M.; Khan, N.U.; Khattak, I.; Kamal, M.; Usman, T. Antimicrobial Usage and Detection of Multidrug-Resistant Staphylococcus aureus: Methicillin- and Tetracycline-Resistant Strains in Raw Milk of Lactating Dairy Cattle. Antibioiotics 2023, 12, 673. [Google Scholar] [CrossRef]
- Sadat, A.; Shata, R.R.; Farag, A.M.M.; Ramadan, H.; Alkhedaide, A.; Soliman, M.M.; Elbadawy, M.; Abugomaa, A.; Awad, A. Prevalence and Characterization of PVL-Positive Staphylococcus aureus Isolated from Raw Cow’s Milk. Toxins 2022, 14, 97. [Google Scholar] [CrossRef] [PubMed]
- Hassan, M.M.; El Zowalaty, M.E.; Lundkvist, A.; Jarhult, J.D.; Khan Nayem, M.R.; Tanzin, A.Z.; Badsha, M.R.; Khan, S.A.; Ashour, H.M. Residual antimicrobial agents in food originating from animals. Trends Food Sci. Technol. 2021, 111, 141–150. [Google Scholar] [CrossRef]
- Khatun, R.; Howlader, A.J.; Ahmed, S.; Islam, N.; Alam, K.; Haider, S.; Mahmud, M.S.; Hasan, M.A. Validation of the declared withdrawal periods of antibiotics. Univers. J. Public Health 2018, 6, 14–22. [Google Scholar] [CrossRef]
- Arfatahery, N.; Mirshafiey, A.; Abedimohtasab, T.; Zeinolabedinizamani, M. Study of the prevalence of Staphylococcus aureus in marine and farmed shrimps in Iran aiming the future development of a prophylactic vaccine. Procedia Vaccinol. 2015, 9, 44–49. [Google Scholar] [CrossRef]
- Kitaya, S.; Miura, C.; Suzuki, A.; Imai, Y.; Tokuda, K.; Kanamori, H. Diabetic Foot Osteomyelitis Caused by Co-Infection with Methicillin-Resistant Staphylococcus aureus and Multidrug-Resistant Extended-Spectrum ß-Lactamase-Producing Escherichia coli: A Case Report. Appl. Microbiol. 2023, 3, 1046–1056. [Google Scholar] [CrossRef]
- Altayb, H.N.; Elbadawi, H.S.; Baothman, O.; Kazmi, I.; Alzahrani, F.A.; Nadeem, M.S.; Hosawi, S.; Chaieb, K. Whole-genome sequence of multidrug-resistant methicillin-resistant Staphylococcus epidermidis carrying biofilm-associated genes and a unique composite of SCCmec. Antibiotics 2022, 11, 861. [Google Scholar] [CrossRef]
- Rajan, V.; Sivaraman, G.K.; Vijayan, A.; Elangovan, R.; Prendiville, A.; Bachmann, T.T. Genotypes and phenotypes of methicillin-resistant staphylococci isolated from shrimp aquaculture farms. Environ. Microbiol. Rep. 2022, 14, 391–399. [Google Scholar] [CrossRef]
- Thornber, K.; Verner-Jeffreys, D.; Hinchliffe, S.; Rahman, M.M.; Bass, D.; Tyler, C.R. Evaluating antimicrobial resistance in the global shrimp industry. Rev. Aquac. 2020, 12, 966–986. [Google Scholar] [CrossRef]
- Uddin, T.M.; Chakraborty, A.J.; Khusro, A.; Zidan, B.R.M.; Mitra, S.; Emran, T.B.; Dhama, K.; Ripon, M.K.H.; Gajdacs, M.; Sahibzada, M.U.K.; et al. Antibiotic resistance in microbes: History, mechanisms, therapeutic strategies and future prospects. J. Infect. Public Health 2021, 14, 1750–1766. [Google Scholar] [CrossRef]
- Wistrand-Yuen, E.; Knopp, M.; Hjort, K.; Koskiniemi, S.; Berg, O.G.; Andersson, D.I. Evolution of high-level resistance during low-level antibiotic exposure. Nat. Commun. 2018, 9, 1599. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Zhang, L. Nanomaterials arising amid antibiotic resistance. Nat. Rev. Microbiol. 2021, 19, 5–6. [Google Scholar] [CrossRef]
- D’Anna, E.; Petrini, F.M.; Artoni, F.; Popovic, I.; Simanic, I.; Raspopovic, S.; Micera, S. A somatotopic bidirectional hand prosthesis with transcutaneous electrical nerve stimulation based sensory feedback. Sci. Rep. 2017, 7, 10930. [Google Scholar] [CrossRef]
- Kharissova, O.V.; Torres-Martínez, L.M.; Kharisov, B.I. Handbook of Nanomaterials and Nanocomposites for Energy and Environmental Applications; Springer: Berlin/Heidelberg, Germany, 2021; ISBN 9783030362683. [Google Scholar]
- Kuhn, R.; Bryant, I.M.; Jensch, R.; Böllmann, J. Applications of environmental nanotechnologies in remediation, wastewater treatment, drinking water treatment, and agriculture. Appl. Nano 2022, 3, 54–90. [Google Scholar] [CrossRef]
- Dawadi, S.; Katuwal, S.; Gupta, A.; Lamichhane, U.; Thapa, R.; Jaisi, S.; Lamichhane, G.; Bhattarai, D.P.; Parajuli, N. Current research on silver nanoparticles: Synthesis, characterization, and applications. J. Nanomater. 2021, 2021, 1–23. [Google Scholar] [CrossRef]
- Golbashy, M.; Sabahi, H.; Allahdadi, I.; Nazokdast, H.; Hosseini, M. Synthesis of highly intercalated urea-clay nanocomposite via domestic montmorillonite as eco-friendly slow-release fertilizer. Arch. Agron. Soil. Sci. 2017, 63, 84–95. [Google Scholar] [CrossRef]
- Priya; Naveen; Kaur, K.; Sidhu, A.K. Green synthesis: An eco-friendly route for the synthesis of iron oxide nanoparticles. Front. Nanotechnol. 2021, 3, 655062. [Google Scholar] [CrossRef]
- Wardani, G.; Sudjarwo, S.A. In vitro antibacterial activity of chitosan nanoparticles against Mycobacterium tuberculosis. Pharmacogn. J. 2018, 10, 162–166. [Google Scholar] [CrossRef]
- Banerjee, S.; Bairagi, S.; Banerjee, S.; Ali, S.W.; Naik, S. Recent advances in nanobiotechnology for medical textiles. Adv. Healthc. Prot. Text. 2023, 2023, 151–171. [Google Scholar] [CrossRef]
- Tamara, F.R.; Lin, C.; Mi, F.L.; Ho, Y.C. Antibacterial Effects of Chitosan/Cationic Peptide Nanoparticles. Nanomaterials 2018, 8, 88. [Google Scholar] [CrossRef] [PubMed]
- Tyagi, A.; Agarwal, S.; Leekha, A.; Verma, A.K. Effect of mass and aspect heterogeneity of chitosan nanoparticles on bactericidal activity. Int. J. Adv. Res. 2014, 2, 357–367. [Google Scholar]
- Savvidou, M.G.; Kontari, E.; Kalantzi, S.; Mamma, D. Green Synthesis of Silver Nanoparticles Using the Cell-Free Supernatant of Haematococcus pluvialis Culture. Materials 2023, 17, 187. [Google Scholar] [CrossRef]
- Gong, D.; Celi, N.; Zhang, D.; Cai, J. Magnetic Biohybrid Microrobot Multimers Based on Chlorella Cells for Enhanced Targeted Drug Delivery. ACS Appl. Mater. Interfaces 2022, 14, 6320–6330. [Google Scholar] [CrossRef] [PubMed]
- Gu, B.; Cai, J.; Peng, G.; Zhou, H.; Zhang, W.; Zhang, D.; Gong, D. Metal organic framework-loaded biohybrid magnetic microrobots for enhanced antibacterial treatment. Colloids Surf. A Physicochem. Eng. Asp. 2024, 685, 133295. [Google Scholar] [CrossRef]
- Draviana, H.T.; Fitriannisa, I.; Khafid, M.; Krisnawati, D.I.; Widodo; Lai, C.H.; Fan, Y.J.; Kuo, T.R. Size and charge effects of metal nanoclusters on antibacterial mechanisms. J. Nanobiotechnol. 2023, 21, 428. [Google Scholar] [CrossRef]
- Qi, L.; Xu, Z.; Jiang, X.; Hu, C.; Zou, X. Preparation and antibacterial activity of chitosan nanoparticles. Carbohydr. Res. 2004, 339, 2693–2700. [Google Scholar] [CrossRef]
- Sarkar, M.R.; Rashid, M.H.-o.; Rahman, A.; Kafi, M.A.; Hosen, M.I.; Rahman, M.S.; Khan, M.N. Recent advances in nanomaterials based sustainable agriculture: An overview. Environ. Nanotechnol. Monit. Manag. 2022, 18, 100687. [Google Scholar] [CrossRef]
- Sharma, D.; Kanchi, S.; Bisetty, K. Biogenic synthesis of nanoparticles: A review. Arab. J. Chem. 2019, 12, 3576–3600. [Google Scholar] [CrossRef]
- Shahid-ul-Islam; Butola, B.S.; Verma, D. Facile Synthesis of Chitosan-Silver Nanoparticles onto Linen for Antibacterial Activity and Free-Radical Scavenging Textiles. Int. J. Biol. Macromol. 2019, 133, 1134–1141. [Google Scholar] [CrossRef]
- Parveen, K.; Banse, V.; Ledwani, L. Green Synthesis of Nanoparticles: Their Advantages and Disadvantages. AIP Conf. Proc. 2016, 1724, 020048. [Google Scholar] [CrossRef]
- Sabouri, Z.; Sabouri, M.; Amiri, M.S.; Khatami, M.; Darroudi, M. Plant-based synthesis of cerium oxide nanoparticles using Rheum turkestanicum extract and evaluation of their cytotoxicity and photocatalytic properties. Mater. Technol. 2022, 37, 555–568. [Google Scholar] [CrossRef]
- Kim, S.W.; Jung, J.H.; Lamsal, K.; Kim, Y.S.; Min, J.S.; Lee, Y.S. Antifungal effects of silver nanoparticles (AgNPs) against various plant pathogenic fungi. Mycobiology 2012, 40, 53–58. [Google Scholar] [CrossRef]
- Mahmud, H.; Hossain, I.; Ahmad, M. Plant extracts, BAU-biofungicide and fungicides in controlling some important diseases of Rice cv. BRRI Dhan40. Am. J. Phytomed. Clin. Ther. 2018, 6, 7. [Google Scholar] [CrossRef]
- Kafi, M.A.; Paul, A.; Vilouras, A.; Hosseini, E.S.; Dahiya, R.S. Chitosan-graphene oxide-based ultra-thin and flexible sensor for diabetic wound monitoring. IEEE Sens. J. 2019, 20, 6794–6801. [Google Scholar] [CrossRef]
- Rahman, A.; Roy, K.J.; Rahman, K.A.; Aktar, M.K.; Kafi, M.A.; Islam, M.S.; Rahman, M.B.; Islam, M.R.; Hossain, K.S.; Rahman, M.M. Adhesion and proliferation of living cell on surface functionalized with glycine nanostructures. Nano Sel. 2022, 3, 188–200. [Google Scholar] [CrossRef]
- Kanwal, Z.; Raza, M.A.; Riaz, S.; Manzoor, S.; Tayyeb, A.; Sajid, I.; Naseem, S. Synthesis and characterization of silver nanoparticle-decorated cobalt nanocomposites (Co@ AgNPs) and their density-dependent antibacterial activity. R. Soc. Open Sci. 2019, 6, 182135. [Google Scholar] [CrossRef]
- Rahman, A.; Rasid, H.; Ali, M.I.; Yeachin, N.; Alam, M.S.; Hossain, K.S.; Kafi, M.A. Facile Synthesis and Application of Ag-NPs for Controlling Antibiotic-ResistantPseudomonas spp. and Bacillus spp. in a Poultry Farm Environment. J. Nanotechnol. 2023, 2023, 6260066. [Google Scholar] [CrossRef]
- Lika, E.; Kostić, M.; Vještica, S.; Milojević, I.; Puvača, N. Honeybee and plant products as natural antimicrobials in enhancement of poultry health and production. Sustainability 2021, 13, 8467. [Google Scholar] [CrossRef]
- Ribeiro, E.F.; de Barros-Alexandrino, T.T.; Assis, O.B.G.; Junior, A.C.; Quiles, A.; Hernando, I.; Nicoletti, V.R. Chitosan and crosslinked chitosan nanoparticles: Synthesis, characterization and their role as Pickering emulsifiers. Carbohydr. Polym. 2020, 250, 116878. [Google Scholar] [CrossRef] [PubMed]
- Maluin, F.N.; Hussein, M.Z. Chitosan-based agronanochemicals as a sustainable alternative in crop protection. Molecules 2020, 25, 1611. [Google Scholar] [CrossRef] [PubMed]
- Silva, M.M.; Calado, R.; Marto, J.; Bettencourt, A.; Almeida, A.J.; Gonçalves, L.M. Chitosan nanoparticles as a mucoadhesive drug delivery system for ocular administration. Mar. Drugs 2017, 15, 370. [Google Scholar] [CrossRef] [PubMed]
- Mohammed, M.A.; Syeda, J.T.M.; Wasan, K.M.; Wasan, E.K. An Overview of Chitosan Nanoparticles and Its Application in Non-Parenteral Drug Delivery. Pharmaceutics 2017, 9, 53. [Google Scholar] [CrossRef] [PubMed]
- Saad, A.M.; Alabdali, A.Y.M.; Ebaid, M.; Salama, E.; El-Saadony, M.T.; Selim, S.; Safhi, F.A.; ALshamrani, S.M.; Abdalla, H.; Mahdi, A.H. Impact of green chitosan nanoparticles fabricated from shrimp processing waste as a source of nano nitrogen fertilizers on the yield quantity and quality of wheat (Triticum aestivum L.) cultivars. Molecules 2022, 27, 5640. [Google Scholar] [CrossRef]
- Benettayeb, A.; Seihoub, F.Z.; Pal, P.; Ghosh, S.; Usman, M.; Chia, C.H.; Usman, M.; Sillanpää, M. Chitosan nanoparticles as potential nano-sorbent for removal of toxic environmental pollutants. Nanomaterials 2023, 13, 447. [Google Scholar] [CrossRef] [PubMed]
- Vilouras, A.; Paul, A.; Kafi, M.A.; Dahiya, R. Graphene Oxide-Chitosan Based Ultra-Flexible Electrochemical Sensor for Detection of Serotonin. In Proceedings of the IEEE Sensors, New Delhi, India, 28–31 October 2018; pp. 1–4. [Google Scholar] [CrossRef]
- Kafi, M.A.; Paul, A.; Vilouras, A.; Dahiya, R. Chitosan-Graphene Oxide Based Ultra-Thin Conformable Sensing Patch for Cell-Health Monitoring. In Proceedings of the IEEE Sensors, New Delhi, India, 28–31 October 2018; pp. 1–4. [Google Scholar] [CrossRef]
- Kafi, M.A.; Paul, A.; Vilouras, A.; Dahiya, R. Mesoporous chitosan based conformable and resorbable biostrip for dopamine detection. Biosens. Bioelectron. 2020, 147, 111781. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Gao, Y.; Shu, J.; Zhang, C.; Zhao, K. Chitosan-based nanomaterial as immune adjuvant and delivery carrier for vaccines. Vaccines 2022, 10, 1906. [Google Scholar] [CrossRef]
- El-Sissi, A.F.; Mohamed, F.H.; Danial, N.M.; Gaballah, A.Q.; Ali, K.A. Chitosan and chitosan nanoparticles as adjuvant in local Rift Valley Fever inactivated vaccine. 3 Biotech. 2020, 10, 88. [Google Scholar] [CrossRef]
- Ali, M.E.A.; Aboelfadl, M.M.S.; Selim, A.M.; Khalil, H.F.; Elkady, G.M. Chitosan nanoparticles extracted from shrimp shells, application for removal of Fe (II) and Mn (II) from aqueous phases. Sep. Sci. Technol. 2018, 53, 2870–2881. [Google Scholar] [CrossRef]
- Kafi, M.A.; Aktar, M.K.; Phanny, Y.; Todo, M. Adhesion, proliferation and differentiation of human mesenchymal stem cell on chitosan/collagen composite scaffold. J. Mater. Sci. Mater. Med. 2019, 30, 131. [Google Scholar] [CrossRef] [PubMed]
- Oh, J.-W.; Chun, S.C.; Chandrasekaran, M. Preparation and in vitro characterization of chitosan nanoparticles and their broad-spectrum antifungal action compared to antibacterial activities against phytopathogens of tomato. Agronomy 2019, 9, 21. [Google Scholar] [CrossRef]
- Van Bavel, N.; Issler, T.; Pang, L.; Anikovskiy, M.; Prenner, E.J. A Simple Method for Synthesis of Chitosan Nanoparticles with Ionic Gelation and Homogenization. Molecules 2023, 28, 4328. [Google Scholar] [CrossRef]
- Laghrib, F.; Farahi, A.; Bakasse, M.; Lahrich, S.; El Mhammedi, M. Chemical synthesis of nanosilver on chitosan and electroanalysis activity against the p-nitroaniline reduction. J. Electroanal. Chem. 2019, 845, 111–118. [Google Scholar] [CrossRef]
- Bashir, S.M.; Ahmed Rather, G.; Patricio, A.; Haq, Z.; Sheikh, A.A.; Shah, M.; Singh, H.; Khan, A.A.; Imtiyaz, S.; Ahmad, S.B.; et al. Chitosan Nanoparticles: A Versatile Platform for Biomedical Applications. Materials 2022, 15, 6521. [Google Scholar] [CrossRef] [PubMed]
- Songjiang, Z.; Lixiang, W. Amyloid-beta associated with chitosan nano-carrier has favorable immunogenicity and permeates the BBB. Aaps Pharmscitech 2009, 10, 900–905. [Google Scholar] [CrossRef]
- Primozic, M.; Knez, Z.; Leitgeb, M. (Bio)nanotechnology in Food Science-Food Packaging. Nanomaterials 2021, 11, 292. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Liu, P.; Si, C.; Liu, Z. Chitosan nanoparticles: Preparation and application in antibacterial paper. J. Macromol. Sci. Part. B 2010, 49, 994–1001. [Google Scholar] [CrossRef]
- Ali, S.W.; Joshi, M.; Rajendran, S. Synthesis and characterization of chitosan nanoparticles with enhanced antimicrobial activity. Int. J. Nanosci. 2011, 10, 979–984. [Google Scholar] [CrossRef]
- Abdelrehim, M.M.; Mohy El Din, M.H.; El-Shabrawy, S.M.; Fahmy, A.E.; Abdelhamid, S.M.; Ramadan, H.S. Synthesis and characterization of metallic and polymeric nanoparticles and their effect on the antibacterial properties of microhybrid composite resin. Alex. Dent. J. 2019, 44, 39–45. [Google Scholar] [CrossRef]
- Anand, M.; Sathyapriya, P.; Maruthupandy, M.; Beevi, A.H. Synthesis of chitosan nanoparticles by TPP and their potential mosquito larvicidal application. Front. Lab. Med. 2018, 2, 72–78. [Google Scholar] [CrossRef]
- Yolanda, Y.D.; Zahra, F.; Nurhayati, M.; Khoerunnisa, F. Synthesis and characterization of Chitosan nanoparticles by ionic gelation method. AIP Conf. Proc. 2023, 2580, 050017. [Google Scholar] [CrossRef]
- Ghadi, A.; Mahjoub, S.; Tabandeh, F.; Talebnia, F. Synthesis and optimization of chitosan nanoparticles: Potential applications in nanomedicine and biomedical engineering. Casp. J. Intern. Med. 2014, 5, 156–161. [Google Scholar] [PubMed Central]
- He, M.; Zhang, J.; Wang, H.; Kong, Y.; Xiao, Y.; Xu, W. Material and Optical Properties of Fluorescent Carbon Quantum Dots Fabricated from Lemon Juice via Hydrothermal Reaction. Nanoscale Res. Lett. 2018, 13, 175. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.K.; Pal, T. Interparticle coupling effect on the surface plasmon resonance of gold nanoparticles: From theory to applications. Chem. Rev. 2007, 107, 4797–4862. [Google Scholar] [CrossRef] [PubMed]
- Shankar, R.; Groven, L.; Amert, A.; Whites, K.W.; Kellar, J.J. Non-aqueous synthesis of silver nanoparticles using tin acetate as a reducing agent for the conductive ink formulation in printed electronics. J. Mater. Chem. 2011, 21, 10871–10877. [Google Scholar] [CrossRef]
- Rodrigues, S.; da Costa, A.M.; Grenha, A. Chitosan/carrageenan nanoparticles: Effect of cross-linking with tripolyphosphate and charge ratios. Carbohydr. Polym. 2012, 89, 282–289. [Google Scholar] [CrossRef] [PubMed]
- Abdelgawad, A.M.; Hudson, S.M. Chitosan nanoparticles: Polyphosphates cross-linking and protein delivery properties. Int. J. Biol. Macromol. 2019, 136, 133–142. [Google Scholar] [CrossRef] [PubMed]
- Geçer, A.; Yıldız, N.; Çalımlı, A.; Turan, B. Trimethyl chitosan nanoparticles enhances dissolution of the poorly water soluble drug candesartan-cilexetil. Macromol. Res. 2010, 18, 986–991. [Google Scholar] [CrossRef]
- Pandey, V.K.; Upadhyay, S.N.; Niranjan, K.; Mishra, P.K. Antimicrobial biodegradable chitosan-based composite Nano-layers for food packaging. Int. J. Biol. Macromol. 2020, 157, 212–219. [Google Scholar] [CrossRef]
- El-Naggar, N.E.; Shiha, A.M.; Mahrous, H.; Mohammed, A.B.A. Green synthesis of chitosan nanoparticles, optimization, characterization and antibacterial efficacy against multi drug resistant biofilm-forming Acinetobacter baumannii. Sci. Rep. 2022, 12, 19869. [Google Scholar] [CrossRef] [PubMed]
- Morsy, M.; Mostafa, K.; Amyn, H.; El-Ebissy, A.A.-h.; Salah, A.M.; Youssef, M.A. Synthesis and characterization of freeze dryer chitosan nano particles as multi functional eco-friendly finish for fabricating easy care and antibacterial cotton textiles. Egyp. J. Chem. 2019, 62, 1277–1293. [Google Scholar] [CrossRef]
- Varma, R.; Vasudevan, S.; Chelladurai, S.; Narayanasamy, A. Synthesis and physicochemical characteristics of chitosan extracted from Pinna deltoides. Lett. Appl. NanoBioSci. 2022, 11, 4061–4070. [Google Scholar] [CrossRef]
- Kahdestani, S.A.; Shahriari, M.H.; Abdouss, M. Synthesis and characterization of chitosan nanoparticles containing teicoplanin using sol–gel. Polym. Bull. 2021, 78, 1133–1148. [Google Scholar] [CrossRef]
- Yusefi, M.; Kia, P.; Sukri, S.N.A.M.; Ali, R.R.; Shameli, K. Synthesis and properties of chitosan nanoparticles crosslinked with tripolyphosphate. J. Res. Nanosci. Nanotechnol. 2021, 3, 46–52. [Google Scholar] [CrossRef]
- Nguyen, N.T.; Nguyen, N.T.; Nguyen, V.A. In situ synthesis and characterization of ZnO/chitosan nanocomposite as an adsorbent for removal of Congo red from aqueous solution. Adv. Polym. Technol. 2020, 2020, 1–8. [Google Scholar] [CrossRef]
- Rezazadeh, N.H.; Buazar, F.; Matroodi, S. Synergistic effects of combinatorial chitosan and polyphenol biomolecules on enhanced antibacterial activity of biofunctionalized silver nanoparticles. Sci. Rep. 2020, 10, 19615. [Google Scholar] [CrossRef] [PubMed]
- Lotfi, S.; Ghaderi, F.; Bahari, A.; Mahjoub, S. Preparation and characterization of magnetite–chitosan nanoparticles and evaluation of their cytotoxicity effects on MCF7 and fibroblast cells. J. Supercond. Nov. Magn. 2017, 30, 3431–3438. [Google Scholar] [CrossRef]
- Goswami, P.; Mathur, J. Positive and negative effects of nanoparticles on plants and their applications in agriculture. Plant Sci. Today 2019, 6, 232–242. [Google Scholar] [CrossRef]
- White, R.J.; Luque, R.; Budarin, V.L.; Clark, J.H.; Macquarrie, D.J. Supported metal nanoparticles on porous materials. Methods and applications. Chem. Soc. Rev. 2009, 38, 481–494. [Google Scholar] [CrossRef]
- Chouhan, S.; Sharma, K.; Guleria, S. Antimicrobial activity of some essential oils—Present status and future perspectives. Medicines 2017, 4, 58. [Google Scholar] [CrossRef] [PubMed]
- Feris, K.; Otto, C.; Tinker, J.; Wingett, D.; Punnoose, A.; Thurber, A.; Kongara, M.; Sabetian, M.; Quinn, B.; Hanna, C.; et al. Electrostatic interactions affect nanoparticle-mediated toxicity to gram-negative bacterium Pseudomonas aeruginosa PAO1. Langmuir 2010, 26, 4429–4436. [Google Scholar] [CrossRef] [PubMed]
- Pimpang, P.; Sumang, R.; Choopun, S. Effect of concentration of citric acid on size and optical properties of fluorescence graphene quantum dots prepared by tuning carbonization degree. Chiang Mai J. Sci. 2018, 45, 2005. [Google Scholar]
- Mahiuddin, M.; Ochiai, B. Green synthesis of crystalline bismuth nanoparticles using lemon juice. RSC Adv. 2021, 11, 26683–26686. [Google Scholar] [CrossRef]
- Mahiuddin, M.; Ochiai, B. Comprehensive Study on Lemon Juice-Based Green Synthesis and Catalytic Activity of Bismuth Nanoparticles. ACS Omega 2022, 7, 35626–35634. [Google Scholar] [CrossRef] [PubMed]
- Sivanesan, I.; Gopal, J.; Muthu, M.; Shin, J.; Mari, S.; Oh, J. Green Synthesized Chitosan/Chitosan Nanoforms/Nanocomposites for Drug Delivery Applications. Polymers 2021, 13, 2256. [Google Scholar] [CrossRef] [PubMed]
- Roy, K.J.; Rahman, A.; Hossain, K.S.; Rahman, M.B.; Kafi, M.A. Antibacterial Investigation of Silver Nanoparticle against Staphylococcus, E. coli and Salmonella Isolated from Selected Live Bird Markets Kumar. Appl. Microbiol. Open Access Res. 2020, 6, 173. [Google Scholar] [CrossRef]
- Wolfensberger, A.; Kuster, S.P.; Marchesi, M.; Zbinden, R.; Hombach, M. The effect of varying multidrug-resistence (MDR) definitions on rates of MDR gram-negative rods. Antimicrob. Resist. Infect. Control 2019, 8, 193. [Google Scholar] [CrossRef]
- Vesterholm-Nielsen, M.; Ølholm Larsen, M.; Elmerdahl Olsen, J.; Møller Aarestrup, E. Occurrence of the BlaZ Gene in Penicillin Resistant Staphylococcus aureus Isolated from Bovine Mastitis in Denmark. Acta Vet. Scand. 1999, 40, 279–286. [Google Scholar] [CrossRef]
- Ghasemi, M.; Turnbull, T.; Sebastian, S.; Kempson, I. The MTT Assay: Utility, Limitations, Pitfalls, and Interpretation in Bulk and Single-Cell Analysis. Int. J. Mol. Sci. 2021, 22, 12827. [Google Scholar] [CrossRef]
- Sivalingam, S.; Kunhilintakath, A.; Nagamony, P.; Paspulathi Parthasarathy, V. Fabrication, toxicity and biocompatibility of Sesamum indicum infused graphene oxide nanofiber-a novel green composite method. Appl. Nanosci. 2021, 11, 679–686. [Google Scholar] [CrossRef]
- Beveridge, T.J. Use of the gram stain in microbiology. Biotech. Histochem. 2001, 76, 111–118. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Standards Institute. M07 Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; CLSI: Wayne, PA, USA, 2018; p. 112. [Google Scholar]
- Brakstad, O.G.; Aasbakk, K.; Maeland, J.A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. J. Clin. Microbiol. 1992, 30, 1654–1660. [Google Scholar] [CrossRef] [PubMed]
- Vazquez-Sanchez, D.; Lopez-Cabo, M.; Saa-Ibusquiza, P.; Rodriguez-Herrera, J.J. Incidence and characterization of Staphylococcus aureus in fishery products marketed in Galicia (Northwest Spain). Int. J. Food Microbiol. 2012, 157, 286–296. [Google Scholar] [CrossRef] [PubMed]
- Mamun, M.M.; Parvej, M.S.; Ahamed, S.; Hassan, J.; Nazir, K.H.M.N.H.; Nishikawa, Y.; Rahman, M.T. Prevalence and Characterization of Shigatoxigenic Escherichia coli in Broiler Birds in Mymensingh. Bangladesh J. Vet. Med. 2016, 14, 5–8. [Google Scholar] [CrossRef]
- Cho, S.; Nguyen, H.A.T.; McDonald, J.M.; Woodley, T.A.; Hiott, L.M.; Barrett, J.B.; Jackson, C.R.; Frye, J.G. Genetic Characterization of Antimicrobial-Resistant Escherichia coli Isolated from a Mixed-Use Watershed in Northeast Georgia, USA. Int. J. Environ. Res. Public Health 2019, 16, 3761. [Google Scholar] [CrossRef] [PubMed]
- Dolinsky, A.L. M100 Performance Standards for Antimicrobial Susceptibility Testing; CLSI: Wayne, PA, USA, 2017; Volume 8, ISBN 0956-4624. [Google Scholar]
- Chikezie, I.O. Determination of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) Using a Novel Dilution Tube Method. Afr. J. Microbiol. Res. 2017, 11, 977–980. [Google Scholar] [CrossRef]
- Ulagesan, S.; Nam, T.-J.; Choi, Y.-H. Biogenic preparation and characterization of Pyropia yezoensis silver nanoparticles (Py AgNPs) and their antibacterial activity against Pseudomonas aeruginosa. Bioprocess. Biosyst. Eng. 2021, 44, 443–452. [Google Scholar] [CrossRef]
- Abdul Kafi, M.; El-Said, W.A.; Kim, T.H.; Choi, J.W. Cell adhesion, spreading, and proliferation on surface functionalized with RGD nanopillar arrays. Biomaterials 2012, 33, 731–739. [Google Scholar] [CrossRef]
Sl No. | Synthesis Protocol | Reducing Agents/Cross-Linker | Compliance with | Antibacterial Activity against MDR Bacteria | Ref. | |
---|---|---|---|---|---|---|
Green Synthesis | Biocompatibility | |||||
1 | Ionic gelation | STPP (Sodium tripolyphosphate) | Do not comply | Do not comply | Not performed | [55] |
2 | Ionic gelation | STPP | Do not comply | Do not comply | Not performed | [56] |
3 | Chemical | NaBH4 | Do not comply | Do not comply | Not performed | [57] |
4 | Reverse micellar | Sodium bis-(2-ethylhexyl) sulphosuccinate | Do not comply | Do not comply | Not performed | [58] |
5 | Emulsification | Glutaraldehyde | Do not comply | Do not comply | Not performed | [59] |
6 | Nano Precipitation | Acetone, Methanol | Do not comply | Do not comply | Not performed | [58] |
7 | Chemical | NaNO2 | Do not comply | Do not comply | Not performed | [60] |
8 | Chemical | NaOH | Do not comply | Do not comply | Not performed | [61] |
9 | Ionic gelation | STPP | Do not comply | Do not comply | Not performed | [62] |
10 | Ionic gelation | STPP | Do not comply | Do not comply | Not performed | [63] |
11 | Ionic gelation | STPP | Do not comply | Do not comply | Not performed | [64] |
12 | Ionic gelation | STPP | Do not comply | Do not comply | Not performed | [65] |
13 | Chemical | NaOH | Do not comply | Do not comply | Not performed | [66] |
14 | Green synthesis | Lemon juice | Comply | Comply | Performed | This work |
Bacteria | Primers | Sequences (5′-3′) | Targeted Genes | Amplicon Size (bp) | Ref. |
---|---|---|---|---|---|
S. aureus | nuc-F | GCGATTGATGGTGATACGGTC | nuc | 270 | [97] |
nuc-F | AGCCAAGCCTTGACGAACTAAAC | ||||
blaZ-F | AAGAGATTTGCCTATGCTTC | blaZ | 377 | [98] | |
blaZ-R | GCTTGACCACTTTTATCAGC | ||||
mecA-F | AACAGGTGAATTATTAGCACTTGTAAG | mecA | 533 | [10] | |
mecA-R | ATTGCTGTTAATATTTTTTGAGTTGAA | ||||
E. coli | ECO-1 | GACCTCGGTTTAGTTCACAGA | 16sRNA | 585 | [99] |
ECO-2 | CACACGCTGACGCTGACCA | ||||
aadA1F | TATCAGAGGTAGTTGGCGTCAT | aadA1 | 484 | [100] | |
aadA1R | GTTCCATAGCGTTAAGGTTTCATT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rahman, A.; Kafi, M.A.; Beak, G.; Saha, S.K.; Roy, K.J.; Habib, A.; Faruqe, T.; Siddique, M.P.; Islam, M.S.; Hossain, K.S.; et al. Green Synthesized Chitosan Nanoparticles for Controlling Multidrug-Resistant mecA- and blaZ-Positive Staphylococcus aureus and aadA1-Positive Escherichia coli. Int. J. Mol. Sci. 2024, 25, 4746. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094746
Rahman A, Kafi MA, Beak G, Saha SK, Roy KJ, Habib A, Faruqe T, Siddique MP, Islam MS, Hossain KS, et al. Green Synthesized Chitosan Nanoparticles for Controlling Multidrug-Resistant mecA- and blaZ-Positive Staphylococcus aureus and aadA1-Positive Escherichia coli. International Journal of Molecular Sciences. 2024; 25(9):4746. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094746
Chicago/Turabian StyleRahman, Aminur, Md Abdul Kafi, Geunyoung Beak, Sanjay Kumar Saha, Kumar Jyotirmoy Roy, Ahsan Habib, Tania Faruqe, Mahbubul Pratik Siddique, Md. Shafiqul Islam, Khandker Saadat Hossain, and et al. 2024. "Green Synthesized Chitosan Nanoparticles for Controlling Multidrug-Resistant mecA- and blaZ-Positive Staphylococcus aureus and aadA1-Positive Escherichia coli" International Journal of Molecular Sciences 25, no. 9: 4746. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25094746