Perinatal Use of Citrulline Rescues Hypertension in Adult Male Offspring Born to Pregnant Uremic Rats
Abstract
:1. Introduction
2. Results
2.1. Body Weight and BP
2.2. NO Pathway
2.3. RAS
2.4. Gut Microbiota Composition
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. NO Parameters
4.3. Western Blot
4.4. Analysis of RAS Components Using qPCR
4.5. 16S rRNA Sequencing
4.6. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bromfield, S.; Muntner, P. High blood pressure: The leading global burden of disease risk factor and the need for worldwide prevention programs. Curr. Hypertens. Rep. 2013, 15, 134–136. [Google Scholar] [CrossRef]
- Paauw, N.D.; van Rijn, B.B.; Lely, A.T.; Joles, J.A. Pregnancy as a critical window for blood pressure regulation in mother and child: Programming and reprogramming. Acta Physiol. 2017, 219, 241–259. [Google Scholar] [CrossRef]
- Suzuki, K. The developing world of DOHaD. J. Dev. Orig. Health Dis. 2018, 9, 266–269. [Google Scholar] [CrossRef]
- Paixão, A.D.; Alexander, B.T. How the kidney is impacted by the perinatal maternal environment to develop hypertension. Biol. Reprod. 2013, 89, 144. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal adenine-induced chronic kidney disease programs hypertension in adult male rat offspring: Implications of nitric oxide and gut microbiome derived metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [PubMed]
- Gordon, M.H. Significance of dietary antioxidants for health. Int. J. Mol. Sci. 2012, 13, 173–179. [Google Scholar] [CrossRef] [PubMed]
- Aguayo, E.; Martínez-Sánchez, A.; Fernández-Lobato, B.; Alacid, F. L-Citrulline: A Non-Essential Amino Acid with Important Roles in Human Health. Appl. Sci. 2021, 11, 3293. [Google Scholar] [CrossRef]
- Burton-Freeman, B.; Freeman, M.; Zhang, X.; Sandhu, A.; Edirisinghe, I. Watermelon and L-Citrulline in Cardio-Metabolic Health: Review of the Evidence 2000–2020. Curr. Atheroscler. Rep. 2021, 23, 81. [Google Scholar] [CrossRef]
- Allerton, T.D.; Proctor, D.N.; Stephens, J.M.; Dugas, T.R.; Spielmann, G.; Irving, B.A. l-Citrulline Supplementation: Impact on Cardiometabolic Health. Nutrients 2018, 10, 921. [Google Scholar] [CrossRef] [PubMed]
- Cynober, L.; Moinard, C.; De Bandt, J.P. The 2009 ESPEN Sir David Cuthbertson. Citrulline: A new major signaling molecule or just another player in the pharmaconutrition game? Clin. Nutr. 2010, 29, 545–551. [Google Scholar] [CrossRef] [PubMed]
- Khalaf, D.; Krüger, M.; Wehland, M.; Infanger, M.; Grimm, D. The Effects of Oral l-Arginine and l-Citrulline Supplementation on Blood Pressure. Nutrients 2019, 11, 1679. [Google Scholar] [CrossRef] [PubMed]
- Thompson, L.P.; Al-Hasan, Y. Impact of oxidative stress in fetal programming. J. Pregnancy 2012, 2012, 582748. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Hsu, C.N. Oxidative Stress-Induced Hypertension of Developmental Origins: Preventive Aspects of Antioxidant Therapy. Antioxidants 2022, 11, 511. [Google Scholar] [CrossRef]
- Yang, T.; Santisteban, M.M.; Rodriguez, V.; Li, E.; Ahmari, N.; Carvajal, J.M.; Zadeh, M.; Gong, M.; Qi, Y.; Zubcevic, J.; et al. Gut dysbiosis is linked to hypertension. Hypertension 2015, 65, 1331–1340. [Google Scholar] [CrossRef] [PubMed]
- Calderón-Pérez, L.; Gosalbes, M.J.; Yuste, S.; Valls, R.M.; Pedret, A.; Llauradó, E.; Jimenez-Hernandez, N.; Artacho, A.; Pla-Pagà, L.; Companys, J.; et al. Gut metagenomic and short chain fatty acids signature in hypertension: A cross-sectional study. Sci. Rep. 2020, 10, 6436. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Huang, L.T.; Lee, C.T.; Chan, J.Y.; Hsu, C.N. Maternal citrulline supplementation prevents prenatal N(G)-nitro-L-arginine-methyl ester (L-NAME)-induced programmed hypertension in rats. Biol. Reprod. 2015, 92, 7. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.L.; Sheen, J.M.; Chen, C.C.; Yu, H.R.; Tiao, M.M.; Kuo, H.C.; Huang, L.T. Maternal citrulline supplementation prevents prenatal dexamethasone-induced programmed hypertension. Free Radic. Res. 2014, 48, 580–586. [Google Scholar] [CrossRef]
- Fanelli, C.; Zatz, R. Linking oxidative stress, the renin-angiotensin system, and hypertension. Hypertension 2011, 57, 373–374. [Google Scholar] [CrossRef]
- Kopkan, L.; Cervenka, L. Renal interactions of renin-angiotensin system, nitric oxide and superoxide anion: Implications in the pathophysiology of salt-sensitivity and hypertension. Physiol. Res. 2009, 58, S55–S68. [Google Scholar] [CrossRef]
- Song, R.; Yosypiv, I.V. (Pro)renin Receptor in Kidney Development and Disease. Int. J. Nephrol. 2011, 2011, 247048. [Google Scholar] [CrossRef]
- Campbell, E.L.; Colgan, S.P. Control and dysregulation of redox signalling in the gastrointestinal tract. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 106–120. [Google Scholar] [CrossRef]
- Wan, M.L.Y.; Co, V.A.; El-Nezami, H. Dietary polyphenol impact on gut health and microbiota. Crit. Rev. Food Sci. Nutr. 2021, 61, 690–711. [Google Scholar] [CrossRef]
- Uyanga, V.A.; Amevor, F.K.; Liu, M.; Cui, Z.; Zhao, X.; Lin, H. Potential Implications of Citrulline and Quercetin on Gut Functioning of Monogastric Animals and Humans: A Comprehensive Review. Nutrients 2021, 13, 3782. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Ma, G.; Xie, J.; Xu, K.; Lai, H.; Li, Y.; He, Y.; Yu, H.; Liao, X.; Wang, X.; et al. Differential Gut Microbiota, Dietary Intakes in Constipation Patients with or without Hypertension. Mol. Nutr. Food Res. 2023, 67, e2300208. [Google Scholar] [CrossRef] [PubMed]
- Yan, Q.; Gu, Y.; Li, X.; Yang, W.; Jia, L.; Chen, C.; Han, X.; Huang, Y.; Zhao, L.; Li, P.; et al. Alterations of the Gut Microbiome in Hypertension. Front. Cell Infect. Microbiol. 2017, 7, 381. [Google Scholar] [CrossRef]
- Go, J.; Chang, D.H.; Ryu, Y.K.; Park, H.Y.; Lee, I.B.; Noh, J.R.; Hwang, D.Y.; Kim, B.C.; Kim, K.S.; Lee, C.H. Human gut microbiota Agathobaculum butyriciproducens improves cognitive impairment in LPS-induced and APP/PS1 mouse models of Alzheimer’s disease. Nutr. Res. 2021, 86, 96–108. [Google Scholar] [CrossRef] [PubMed]
- Pluznick, J.L. Microbial short-chain fatty acids and blood pressure regulation. Curr. Hypertens. Rep. 2017, 19, 25. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Yu, H.R.; Lin, I.C.; Tiao, M.M.; Huang, L.T.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Sodium butyrate modulates blood pressure and gut microbiota in maternal tryptophan-free diet-induced hypertension rat offspring. J. Nutr. Biochem. 2022, 108, 109090. [Google Scholar] [CrossRef]
- Si, J.; Lee, C.; Ko, G. Oral Microbiota: Microbial Biomarkers of Metabolic Syndrome Independent of Host Genetic Factors. Front. Cell Infect. Microbiol. 2017, 7, 516. [Google Scholar] [CrossRef]
- Sinha, N.; Dabla, P.K. Oxidative stress and antioxidants in hypertension-a current review. Curr. Hypertens. Rev. 2015, 11, 132–142. [Google Scholar] [CrossRef]
- Griendling, K.K.; Camargo, L.L.; Rios, F.J.; Alves-Lopes, R.; Montezano, A.C.; Touyz, R.M. Oxidative Stress and Hypertension. Circ. Res. 2021, 128, 993–1020. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, S.R.; Kelleher, C.; Khalil, R.A. Gender-based research underscores sex differences in biological processes, clinical disorders and pharmacological interventions. Biochem. Pharmacol. 2023, 215, 115737. [Google Scholar] [CrossRef]
- Bode-Böger, S.M.; Scalera, F.; Ignarro, L.J. The L-arginine paradox: Importance of the L-arginine/asymmetrical dimethylarginine ratio. Pharmacol. Ther. 2007, 114, 295–306. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree 2—Approximately maximum-likelihood trees for large alignments. PLoS ONE 2010, 5, e9490. [Google Scholar] [CrossRef] [PubMed]
Groups | N | CKD | NC | CKDC |
---|---|---|---|---|
Citrulline, μM | 65.6 ± 3.1 | 63.4 ± 1.9 | 74.1 ± 3 # | 63.3 ± 1.8 † |
Arginine, μM | 173.6 ± 15.3 | 154.3 ± 3.5 | 191.7 ± 7.6 # | 172.4 ± 3.7 #† |
ADMA, μM | 2.04 ± 0.09 | 2.65 ± 0.09 * | 1.81 ± 0.19 # | 2.07 ± 0.04 #† |
SDMA, μM | 1.5 ± 0.08 | 2.16 ± 0.12 * | 1.7 ± 0.16 # | 1.91 ± 0.09 |
Ratio of arginine-to-ADMA | 84.6 ± 5.3 | 57.7 ± 3.2 * | 111.1 ± 7.5 *# | 83.6 ± 2.9 #† |
Gene | Accession No | Sense | Antisense |
---|---|---|---|
AGT | XM_032887807.1 | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
Renin | J02941.1 | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
ACE | U03734.1 | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
PRR | AB188298.1 | 5 gaggcagtgaccctcaacat 3 | 5 ccctcctcacacaacaaggt 3 |
AT1R | NM_030985.4 | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
R18S | X01117 | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Hsu, C.-N. Perinatal Use of Citrulline Rescues Hypertension in Adult Male Offspring Born to Pregnant Uremic Rats. Int. J. Mol. Sci. 2024, 25, 1612. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25031612
Tain Y-L, Hou C-Y, Chang-Chien G-P, Lin S, Hsu C-N. Perinatal Use of Citrulline Rescues Hypertension in Adult Male Offspring Born to Pregnant Uremic Rats. International Journal of Molecular Sciences. 2024; 25(3):1612. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25031612
Chicago/Turabian StyleTain, You-Lin, Chih-Yao Hou, Guo-Ping Chang-Chien, Sufan Lin, and Chien-Ning Hsu. 2024. "Perinatal Use of Citrulline Rescues Hypertension in Adult Male Offspring Born to Pregnant Uremic Rats" International Journal of Molecular Sciences 25, no. 3: 1612. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25031612