Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy
Abstract
:1. Introduction
2. Results
2.1. The Placentas of Women with CVD Exhibit Increased Expression of Canonical Inflammasome Components
2.2. The Placentas of Women with CVD Display Enhanced Expression of Non-Canonical Caspase-5 and Caspase-8
3. Discussion
4. Materials and Methods
4.1. Study Design and Participants
4.2. Sample Collection and Processing
4.3. Protein Expression by Immunohistochemistry Assays
4.4. Gene Expression Assessed by Real-Time Quantitative PCR
4.5. Histopathological Assessment
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Santler, B.; Goerge, T. Chronic Venous Insufficiency—A Review of Pathophysiology, Diagnosis, and Treatment. JDDG J. Deutsch. Dermatol. Ges. 2017, 15, 538–556. [Google Scholar] [CrossRef]
- Segiet, O.A.; Brzozowa-Zasada, M.; Piecuch, A.; Dudek, D.; Reichman-Warmusz, E.; Wojnicz, R. Biomolecular Mechanisms in Varicose Veins Development. Ann. Vasc. Surg. 2015, 29, 377–384. [Google Scholar] [CrossRef]
- Ortega, M.A.; Fraile-Martínez, O.; García-Montero, C.; Álvarez-Mon, M.A.; Chaowen, C.; Ruiz-Grande, F.; Pekarek, L.; Monserrat, J.; Asúnsolo, A.; García-Honduvilla, N.; et al. Understanding Chronic Venous Disease: A Critical Overview of Its Pathophysiology and Medical Management. J. Clin. Med. 2021, 10, 3239. [Google Scholar] [CrossRef]
- Cornu-Thenard, A.; Boivin, P. Chronic Venous Disease during Pregnancy—Servier—PhlebolymphologyServier—Phlebolymphology. Phlebolymphology 2014, 21, 138–145. [Google Scholar]
- Taylor, J.; Hicks, C.W.; Heller, J.A. The Hemodynamic Effects of Pregnancy on the Lower Extremity Venous System. J. Vasc. Surg. Venous Lymphat. Disord. 2018, 6, 246–255. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Sánchez-Trujillo, L.; Bravo, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Alvarez-Mon, M.A.; Sainz, F.; Alvarez-Mon, M.; Bujan, J.; et al. Newborns of Mothers with Venous Disease during Pregnancy Show Increased Levels of Lipid Peroxidation and Markers of Oxidative Stress and Hypoxia in the Umbilical Cord. Antioxidants 2021, 10, 980. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Saez, M.A.; Fraile-Martínez, O.; Asúnsolo, Á.; Pekarek, L.; Bravo, C.; Coca, S.; Sainz, F.; Álvarez-Mon, M.; Buján, J.; et al. Increased Angiogenesis and Lymphangiogenesis in the Placental Villi of Women with Chronic Venous Disease during Pregnancy. Int. J. Mol. Sci. 2020, 21, 2487. [Google Scholar] [CrossRef]
- Ortega, M.A.; Gómez-Lahoz, A.M.; Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; Guijarro, L.G.; Bravo, C.; De Leon-Luis, J.A.; Saz, J.V.; Bujan, J.; et al. Chronic Venous Disease during Pregnancy Causes a Systematic Increase in Maternal and Fetal Proinflammatory Markers. Int. J. Mol. Sci. 2022, 23, 8976. [Google Scholar] [CrossRef]
- Ortega, M.A.; Fraile-Martínez, O.; Saez, M.A.; Álvarez-Mon, M.A.; Gómez-Lahoz, A.M.; Bravo, C.; De León Luis, J.A.; Sainz, F.; Coca, S.; Asúnsolo, Á.; et al. Abnormal Proinflammatory and Stressor Environmental with Increased the Regulatory Cellular IGF-1/PAPP-A/STC and Wnt-1/β-Catenin Canonical Pathway in Placenta of Women with Chronic Venous Disease during Pregnancy. Int. J. Med. Sci. 2021, 18, 2814–2827. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Trujillo, L.; Fraile-Martinez, O.; García-Montero, C.; García-Puente, L.M.; Guijarro, L.G.; De Leon-Oliva, D.; Boaru, D.L.; Gardón-Alburquerque, D.; del Val Toledo Lobo, M.; Royuela, M.; et al. Chronic Venous Disease during Pregnancy Is Related to Inflammation of the Umbilical Cord: Role of Allograft Inflammatory Factor 1 (AIF-1) and Interleukins 10 (IL-10), IL-12 and IL-18. J. Pers. Med. 2023, 13, 956. [Google Scholar] [CrossRef]
- Gomez-Lopez, N.; Motomura, K.; Miller, D.; Garcia-Flores, V.; Galaz, J.; Romero, R. Inflammasomes: Their Role in Normal and Complicated Pregnancies. J. Immunol. 2019, 203, 2757–2769. [Google Scholar] [CrossRef] [PubMed]
- Fang, X.; Wang, Y.; Zhang, Y.; Li, Y.; Kwak-kim, J.; Wu, L. NLRP3 Inflammasome and Its Critical Role in Gynecological Disorders and Obstetrical Complications. Front. Immunol. 2021, 11, 555826. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Gil, M.A.; Fraile-Martinez, O.; García-Montero, C.; Toledo, M.D.V.; Guijarro, L.G.; De León-Luis, J.A.; Bravo, C.; Díaz-Pedrero, R.; López-Gonzalez, L.; Saez, M.A.; et al. Histopathological Clues of Enhanced Inflammation in the Placental Tissue of Women with Chronic Venous Disease in Lower Limbs during Pregnancy. J. Pers. Med. 2024, 14, 87. [Google Scholar] [CrossRef] [PubMed]
- Yin, Y.; Yan, Y.; Jiang, X.; Mai, J.; Chen, N.C.; Wang, H.; Yang, X.F. Inflammasomes are differentially expressed in cardiovascular and other tissues. Int. J. Immunopathol. Pharmacol. 2009, 22, 311–322. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Cushman, M.; Callas, P.W.; Allison, M.A.; Criqui, M.H. Inflammation and peripheral venous disease. The San Diego Population Study. Thromb. Haemost. 2014, 112, 566–572. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-Trujillo, L.; García-Montero, C.; Fraile-Martinez, O.; Guijarro, L.G.; Bravo, C.; De Leon-Luis, J.A.; Saez, J.V.; Bujan, J.; Alvarez-Mon, M.; García-Honduvilla, N.; et al. Considering the Effects and Maternofoetal Implications of Vascular Disorders and the Umbilical Cord. Medicina 2022, 58, 1754. [Google Scholar] [CrossRef] [PubMed]
- Castro-Ferreira, R.; Cardoso, R.; Leite-Moreira, A.; Mansilha, A. The Role of Endothelial Dysfunction and Inflammation in Chronic Venous Disease. Ann. Vasc. Surg. 2018, 46, 380–393. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Chaowen, C.; Fraile-Martinez, O.; García-Montero, C.; Saez, M.A.; Cruza, I.; Pereda-Cerquella, C.; Alvarez-Mon, M.A.; Guijarro, L.G.; Fatych, Y.; et al. Chronic Venous Disease in Pregnant Women Causes an Increase in ILK in the Placental Villi Associated with a Decrease in E-Cadherin. J. Pers. Med. 2022, 12, 277. [Google Scholar] [CrossRef]
- Patnaik, N.; Pradhan, N. Chronic Venous Insufficiency in Pregnant Women. Indian J. Vasc. Endovasc. Surg. 2021, 8, 213–215. [Google Scholar] [CrossRef]
- Socha, M.W.; Malinowski, B.; Puk, O.; Dubiel, M.; Wiciński, M. The NLRP3 Inflammasome Role in the Pathogenesis of Pregnancy Induced Hypertension and Preeclampsia. Cells 2020, 9, 1642. [Google Scholar] [CrossRef]
- Agrawal, I.; Jha, S. Comprehensive Review of ASC Structure and Function in Immune Homeostasis and Disease. Mol. Biol. Rep. 2020, 47, 3077–3096. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F.; Li, C.; Zhang, S.Y. NLRP3 Inflammasome: A New Therapeutic Target for High-Risk Reproductive Disorders? Chin. Med. J. 2020, 134, 20–27. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; De Leon-Oliva, D.; García-Montero, C.; Fraile-Martinez, O.; Boaru, D.L.; de Castro, A.V.; Saez, M.A.; Lopez-Gonzalez, L.; Bujan, J.; Alvarez-Mon, M.A.; et al. Reframing the Link between Metabolism and NLRP3 Inflammasome: Therapeutic Opportunities. Front. Immunol. 2023, 14, 1232629. [Google Scholar] [CrossRef] [PubMed]
- García-Honduvilla, N.; Ortega, M.A.; Asúnsolo, Á.; Álvarez-Rocha, M.J.; Romero, B.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J. Placentas from Women with Pregnancy-Associated Venous Insufficiency Show Villi Damage with Evidence of Hypoxic Cellular Stress. Hum. Pathol. 2018, 77, 45–53. [Google Scholar] [CrossRef] [PubMed]
- García-Montero, C.; Fraile-Martinez, O.; Rodriguez-Martín, S.; Funes Moñux, R.M.; Saz, J.V.; Bravo, C.; De Leon-Luis, J.A.; Ruiz-Minaya, M.; Pekarek, L.; Saez, M.A.; et al. Irregular Expression of Cellular Stress Response Markers in the Placenta of Women with Chronic Venous Disease. Antioxidants 2022, 11, 2277. [Google Scholar] [CrossRef] [PubMed]
- Blevins, H.M.; Xu, Y.; Biby, S.; Zhang, S. The NLRP3 Inflammasome Pathway: A Review of Mechanisms and Inhibitors for the Treatment of Inflammatory Diseases. Front. Aging Neurosci. 2022, 14, 879021. [Google Scholar] [CrossRef] [PubMed]
- Ortega, M.A.; Romero, B.; Asúnsolo, Á.; Martínez-Vivero, C.; Sainz, F.; Bravo, C.; De León-Luis, J.; Álvarez-Mon, M.; Buján, J.; García-Honduvilla, N. Pregnancy-Associated Venous Insufficiency Course with Placental and Systemic Oxidative Stress. J. Cell. Mol. Med. 2020, 24, 4157–4170. [Google Scholar] [CrossRef] [PubMed]
- Zhong, B.; Sun, S.; Tan, K.S.; Ong, H.H.; Du, J.; Liu, F.; Liu, Y.; Liu, S.; Ba, L.; Li, J.; et al. Hypoxia-Inducible Factor 1α Activates the NLRP3 Inflammasome to Regulate Epithelial Differentiation in Chronic Rhinosinusitis. J. Allergy Clin. Immunol. 2023, 152, 1444–1459.e14. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Li, J.; Lin, S.; Wu, Y.; He, D.; Qu, P. PI3K Regulates the Activation of NLRP3 Inflammasome in Atherosclerosis through Part-Dependent AKT Signaling Pathway. Exp. Anim. 2021, 70, 488–497. [Google Scholar] [CrossRef]
- Masumoto, J.; Taniguchi, S.; Nakayama, J.; Shiohara, M.; Hidaka, E.; Katsuyama, T.; Murase, S.; Sagara, J. Expression of Apoptosis-Associated Speck-like Protein Containing a Caspase Recruitment Domain, a Pyrin N-Terminal Homology Domain-Containing Protein, in Normal Human Tissues. J. Histochem. Cytochem. 2001, 49, 1269–1275. [Google Scholar] [CrossRef]
- Compan, V.; Martín-Sánchez, F.; Baroja-Mazo, A.; López-Castejón, G.; Gomez, A.I.; Verkhratsky, A.; Brough, D.; Pelegrín, P. Apoptosis-Associated Speck-like Protein Containing a CARD Forms Specks but Does Not Activate Caspase-1 in the Absence of NLRP3 during Macrophage Swelling. J. Immunol. 2015, 194, 1261–1273. [Google Scholar] [CrossRef] [PubMed]
- Dabrowska, C.; Li, M.; Fan, Y. Apoptotic Caspases in Promoting Cancer: Implications from Their Roles in Development and Tissue Homeostasis. Adv. Exp. Med. Biol. 2016, 930, 89–112. [Google Scholar] [CrossRef] [PubMed]
- Zamaraev, A.V.; Kopeina, G.S.; Prokhorova, E.A.; Zhivotovsky, B.; Lavrik, I.N. Post-Translational Modification of Caspases: The Other Side of Apoptosis Regulation. Trends Cell Biol. 2017, 27, 322–339. [Google Scholar] [CrossRef] [PubMed]
- Khan, R.N.; Hay, D.P. A Clear and Present Danger: Inflammasomes DAMPing down Disorders of Pregnancy. Hum. Reprod. Update 2015, 21, 388–405. [Google Scholar] [CrossRef] [PubMed]
- Gotsch, F.; Romero, R.; Chaiworapongsa, T.; Erez, O.; Vaisbuch, E.; Espinoza, J.; Kusanovic, J.P.; Mittal, P.; Mazaki-Tovi, S.; Kim, C.J.; et al. Evidence of the Involvement of Caspase-1 under Physiologic and Pathologic Cellular Stress during Human Pregnancy: A Link Between the Inflammasome and Parturition. J. Matern. Fetal Neonatal Med. 2008, 21, 605. [Google Scholar] [CrossRef] [PubMed]
- Afonina, I.S.; Müller, C.; Martin, S.J.; Beyaert, R. Proteolytic Processing of Interleukin-1 Family Cytokines: Variations on a Common Theme. Immunity 2015, 42, 991–1004. [Google Scholar] [CrossRef] [PubMed]
- Tapia, V.S.; Daniels, M.J.D.; Palazón-Riquelme, P.; Dewhurst, M.; Luheshi, N.M.; Rivers-Auty, J.; Green, J.; Redondo-Castro, E.; Kaldis, P.; Lopez-Castejon, G.; et al. The Three Cytokines IL-1β, IL-18, and IL-1α Share Related but Distinct Secretory Routes. J. Biol. Chem. 2019, 294, 8325. [Google Scholar] [CrossRef]
- Kelley, N.; Jeltema, D.; Duan, Y.; He, Y. The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int. J. Mol. Sci. 2019, 20, 3328. [Google Scholar] [CrossRef]
- Krishnan, S.M.; Sobey, C.G.; Latz, E.; Mansell, A.; Drummond, G.R. IL–1β and IL–18: Inflammatory Markers or Mediators of Hypertension? Br. J. Pharmacol. 2014, 171, 5589. [Google Scholar] [CrossRef]
- Southcombe, J.H.; Redman, C.W.G.; Sargent, I.L.; Granne, I. Interleukin-1 Family Cytokines and Their Regulatory Proteins in Normal Pregnancy and Pre-Eclampsia. Clin. Exp. Immunol. 2015, 181, 480. [Google Scholar] [CrossRef]
- Löb, S.; Vilsmaier, T.; Schmoeckel, E.; Mahner, S.; Wöckel, A.; Jeschke, U. The Cytokines IL-1b and IL-18 Are Upregulated in the Placenta of Recurrent Miscarriage Patients. J. Reprod. Immunol. 2023, 158, 103583. [Google Scholar] [CrossRef]
- Yockey, L.J.; Iwasaki, A. Interferons and Proinflammatory Cytokines in Pregnancy and Fetal Development. Immunity 2018, 49, 397–412. [Google Scholar] [CrossRef] [PubMed]
- Imre, G. Pyroptosis in Health and Disease. Am. J. Physiol. Cell Physiol. 2024, 326, C784–C794. [Google Scholar] [CrossRef] [PubMed]
- Man, S.M.; Karki, R.; Kanneganti, T.D. Molecular Mechanisms and Functions of Pyroptosis, Inflammatory Caspases and Inflammasomes in Infectious Diseases. Immunol. Rev. 2017, 277, 61–75. [Google Scholar] [CrossRef]
- Cheng, S.B.; Nakashima, A.; Huber, W.J.; Davis, S.; Banerjee, S.; Huang, Z.; Saito, S.; Sadovsky, Y.; Sharma, S. Pyroptosis Is a Critical Inflammatory Pathway in the Placenta from Early Onset Preeclampsia and in Human Trophoblasts Exposed to Hypoxia and Endoplasmic Reticulum Stressors. Cell Death Dis. 2019, 10, 927. [Google Scholar] [CrossRef]
- Abrahams, V.M.; Tang, Z.; Mor, G.; Guller, S. NLRP3 Inflammasome Function and Pyroptotic Cell Death in Human Placental Hofbauer Cells. J. Reprod. Immunol. 2020, 142, 103214. [Google Scholar] [CrossRef] [PubMed]
- Mandal, R.; Barrón, J.C.; Kostova, I.; Becker, S.; Strebhardt, K. Caspase-8: The Double-Edged Sword. Biochim. Biophys. Acta (BBA) Rev. Cancer 2020, 1873, 188357. [Google Scholar] [CrossRef] [PubMed]
- Bolívar, B.E.; Brown-Suedel, A.N.; Rohrman, B.A.; Charendoff, C.I.; Yazdani, V.; Belcher, J.D.; Vercellotti, G.M.; Flanagan, J.M.; Bouchier-Hayes, L. Noncanonical Roles of Caspase-4 and Caspase-5 in Heme-Driven IL-1β Release and Cell Death. J. Immunol. 2021, 206, 1878–1889. [Google Scholar] [CrossRef]
- Matikainen, S.; Nyman, T.A.; Cypryk, W. Function and Regulation of Noncanonical Caspase-4/5/11 Inflammasome. J. Immunol. 2020, 204, 3063–3069. [Google Scholar] [CrossRef]
- Yi, Y.S. Regulatory Roles of the Caspase-11 Non-Canonical Inflammasome in Inflammatory Diseases. Immune Netw. 2018, 18, e41. [Google Scholar] [CrossRef]
- Gurung, P.; Kanneganti, T.D. Novel Roles for Caspase-8 in IL-1β and Inflammasome Regulation. Am. J. Pathol. 2015, 185, 17–25. [Google Scholar] [CrossRef] [PubMed]
- Belousova, V.; Svitich, O.; Timokhina, E.; Ignatko, I.; Bogomazova, I.; Pesegova, S.; Silaeva, T.; Kuzmina, T.; Skorobogatova, O. Caspase-3, Caspase-8 and XIAP Gene Expression in the Placenta: Exploring the Causes of Spontaneous Preterm Labour. Int. J. Mol. Sci. 2023, 24, 1692. [Google Scholar] [CrossRef] [PubMed]
- Salman, H.; Shah, M.; Habib, S.H.; Rapisarda, A.M.C.; Riemma, G.; Fichera, M. Pathogenesis of Preeclampsia: Implications of Apoptotic Markers and Oxidative Stress. Hum. Exp. Toxicol. 2013, 32, 27–52. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Puente, L.M.; Fraile-Martinez, O.; García-Montero, C.; Bujan, J.; De León-Luis, J.A.; Bravo, C.; Rodríguez-Benitez, P.; Pintado, P.; Ruiz-Labarta, F.J.; Álvarez-Mon, M.; et al. Placentas from Women with Late-Onset Preeclampsia Exhibit Increased Expression of the NLRP3 Inflammasome Machinery. Biomolecules 2023, 13, 1644. [Google Scholar] [CrossRef] [PubMed]
- Lurie, F.; Passman, M.; Meisner, M.; Dalsing, M.; Masuda, E.; Welch, H.; Bush, R.L.; Blebea, J.; Carpentier, P.H.; De Maeseneer, M.; et al. The 2020 Update of the CEAP Classification System and Reporting Standards. J. Vasc. Surg. Venous Lymphat. Disord. 2020, 8, 342–352. [Google Scholar] [CrossRef]
- Ortega, M.A.; Sáez, M.A.; Fraile-Martínez, O.; Álvarez-Mon, M.A.; García-Montero, C.; Guijarro, L.G.; Asúnsolo, Á.; Álvarez-Mon, M.; Bujan, J.; García-Honduvilla, N.; et al. Overexpression of glycolysis markers in placental tissue of pregnant women with chronic venous disease: A histological study. Int. J. Med. Sci. 2022, 19, 186–194. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
- Chomczynski, P.; Sacchi, N. The Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction: Twenty-Something Years On. Nat. Protoc. 2006, 1, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Jang, S.J.; Jeon, R.H.; Kim, H.D.; Hwang, J.C.; Lee, H.J.; Bae, S.G.; Lee, S.L.; Rho, G.J.; Kim, S.J.; Lee, W.J. TATA Box Binding Protein and Ribosomal Protein 4 Are Suitable Reference Genes for Normalization during Quantitative Polymerase Chain Reaction Study in Bovine Mesenchymal Stem Cells. Asian-Australas. J. Anim. Sci. 2020, 33, 2021–2030. [Google Scholar] [CrossRef]
- Gatto, F.; Feelders, R.A.; Van Der Pas, R.; Kros, J.M.; Waaijers, M.; Sprij-Mooij, D.; Neggers, S.J.C.M.M.; Van Der Lelij, A.J.; Minuto, F.; Lamberts, S.W.J.; et al. Immunoreactivity Score Using an Anti-Sst2A Receptor Monoclonal Antibody Strongly Predicts the Biochemical Response to Adjuvant Treatment with Somatostatin Analogs in Acromegaly. J. Clin. Endocrinol. Metab. 2013, 98, E66–E71. [Google Scholar] [CrossRef]
Clinical Features | CVD (n = 62) | HC (n = 52) |
---|---|---|
Median age (IQR), years | 33 (22–40) | 34 (27–41) |
Median gestational age (IQR), weeks | 40.5 (39–41.5) | 41 (39–42) |
Caesarean delivery, n (%) | 12 (19.4) | 9 (17.3) |
Vaginal delivery, n (%) | 50 (80.6) | 43 (82.7) |
CVD CEAP 1, n (%) | 37 (59.7) | 0 (0) |
CVD CEAP 2, n (%) | 21 (33.8) | 0 (0) |
CVD CEAP 3, n (%) | 4 (6.5) | 0 (0) |
Prior pregnancies, n (%) | 33 (53.2) | 19 (36.5) |
Prior abortions, n (%) | 14 (22.6) | 9 (17.3) |
Regular periods of menstruation, n (%) | 50 (80.6) | 42 (80.7) |
Sedentary profession, n (%) | 41 (66.1) | 40 (76.9) |
Antigen | Species | Dilution | Provider | Protocol Specifications |
---|---|---|---|---|
NLRP3 | Rabbit Monoclonal | 1:500 | Abcam (Cambridge, UK) (ab263,899) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
ASC | Rabbit monoclonal | 1:250 | Abcam (ab283,684) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
Caspase 1 | Rabbit Polyclonal | 1:500 | Abcam (ab62,698) | EDTA pH = 9, before incubation with blocking solution |
Caspase 5 | Rabbit monoclonal | 1:100 | Abcam (ab40,887) | 10 mM Sodium citrate pH = 6, before incubation with blocking solution |
Caspase 8 | Rabbit polyclonal | 1:250 | Abcam (ab25,901) | 100% Triton 0.1% in PBS for 10 min, before incubation with blocking solution |
IL-1β | Rabbit recombinant multiclonal | 1:50 | Abcam (ab283,818) | Not Specifications |
IgG | Hybridoma Rabbit-Mouse monoclonal | 1:1000 | Sigma-Aldrich (RG96/B5283) | Not specifications |
Gene | Sequence Fwd (5′→3′) | Sequence Rev (5′→3′) | Temperature |
---|---|---|---|
TBP | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | 60 °C |
NLRP3 | GCTGGCATCTGGATGAGGAA | GTGTGTCCTGAGCCATGGAA | 61 °C |
ASC | ATCCAGGCCCCTCCTCAG | AGAGCTTCCGCATCTTGCTT | 60 °C |
Caspase 1 | GAAAAGCCATGGCCGACAAG | GCTGTCAGAGGTCTTGTGCT | 57 °C |
Caspase 5 | TGTTAGCTATGGCTGAAGACAGT | TTGATGAGCCACGCGATTCT | 58 °C |
Caspase 8 | GTCTGTACCTTTCTGGCGGA | CTCAGGCTCTGGCAAAGTGA | 60 °C |
IL-1β | AGCCATGGCAGAAGTACCTG | TGAAGCCCTTGCTGTAGTGG | 60 °C |
IL-18 | GCTGAAGATGATGAAAACCTGGA | GAGGCCGATTTCCTTGGTCA | 59 °C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez-Gil, M.A.; Fraile-Martinez, O.; García-Montero, C.; De Leon-Oliva, D.; Boaru, D.L.; De Castro-Martinez, P.; Camacho-Alcázar, A.; De León-Luis, J.A.; Bravo, C.; Díaz-Pedrero, R.; et al. Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy. Int. J. Mol. Sci. 2024, 25, 5528. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25105528
Sánchez-Gil MA, Fraile-Martinez O, García-Montero C, De Leon-Oliva D, Boaru DL, De Castro-Martinez P, Camacho-Alcázar A, De León-Luis JA, Bravo C, Díaz-Pedrero R, et al. Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy. International Journal of Molecular Sciences. 2024; 25(10):5528. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25105528
Chicago/Turabian StyleSánchez-Gil, María Asunción, Oscar Fraile-Martinez, Cielo García-Montero, Diego De Leon-Oliva, Diego Liviu Boaru, Patricia De Castro-Martinez, Adrían Camacho-Alcázar, Juan A. De León-Luis, Coral Bravo, Raúl Díaz-Pedrero, and et al. 2024. "Exacerbated Activation of the NLRP3 Inflammasome in the Placentas from Women Who Developed Chronic Venous Disease during Pregnancy" International Journal of Molecular Sciences 25, no. 10: 5528. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms25105528