Preliminary Evidence of the Differential Expression of Human Endogenous Retroviruses in Kawasaki Disease and SARS-CoV-2-Associated Multisystem Inflammatory Syndrome in Children
Abstract
:1. Introduction
2. Results
2.1. Clinical and Laboratory Characteristics of Kawasaki Disease and Multisystem Inflammatory Syndrome in Children Patients
2.2. HERV ENV, Syncytins, and Their Putative Receptors Are Differentially Expressed in Blood Samples from Paediatric Patients with Kawasaki Disease and Multisystem Inflammatory Syndrome in Children
2.3. Kawasaki Disease and Multisystem Inflammatory Syndrome in Children Share the Deregulation of Inflammatory and Regulatory Cytokines, but They Differ in the Transcriptional Profile of Toll-like Receptors
2.4. The Correlation Analysis Demonstrates an Association among HERVs and Cytokine Expression Only in Patients with Kawasaki Disease and Multisystem Inflammatory Syndrome
3. Discussion
4. Materials and Methods
4.1. Study Design and Participants
4.2. Data Collection
4.3. Ethical Approval
4.4. Sample Preparation, RNA Extraction, and Quantitative RT Real-Time PCR
4.5. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- McCrindle, B.W.; Rowley, A.H.; Newburger, J.W.; Burns, J.C.; Bolger, A.F.; Gewitz, M.; Baker, A.L.; Jackson, M.A.; Takahashi, M.; Shah, P.B.; et al. Diagnosis, Treatment, and Long-Term Management of Kawasaki Disease: A Scientific Statement for Health Professionals From the American Heart Association. Circulation 2017, 135, e927–e999. [Google Scholar] [CrossRef] [PubMed]
- Mauro, A.; Fabi, M.; Da Frè, M.; Guastaroba, P.; Corinaldesi, E.; Calabri, G.B.; Giani, T.; Simonini, G.; Rusconi, F.; Cimaz, R. Kawasaki disease: An epidemiological study in central Italy. Pediatr. Rheumatol. Online J. 2016, 14, 22. [Google Scholar] [CrossRef]
- Ravelli, A.; Martini, A. Kawasaki disease or Kawasaki syndrome? Ann. Rheum. Dis. 2020, 79, 993–995. [Google Scholar] [CrossRef] [PubMed]
- Rodó, X.; Curcoll, R.; Robinson, M.; Ballester, J.; Burns, J.C.; Cayan, D.R.; Lipkin, W.I.; Williams, B.L.; Couto-Rodriguez, M.; Nakamura, Y.; et al. Tropospheric winds from northeastern China carry the etiologic agent of Kawasaki disease from its source to Japan. Proc. Natl. Acad. Sci. USA 2014, 111, 7952–7957. [Google Scholar] [CrossRef]
- Yorifuji, T.; Tsukahara, H.; Kashima, S.; Doi, H. Intrauterine and Early Postnatal Exposure to Particulate Air Pollution and Kawasaki Disease: A Nationwide Longitudinal Survey in Japan. J. Pediatr. 2018, 193, 147–154.e2. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Tang, K.; Levin, M.; Irfan, O.; Morris, S.K.; Wilson, K.; Klein, J.D.; Bhutta, Z.A. COVID-19 and multisystem inflammatory syndrome in children and adolescents. Lancet Infect. Dis. 2020, 20, e276–e288. [Google Scholar] [CrossRef]
- Boehmer, T.K.; DeVies, J.; Caruso, E.; van Santen, K.L.; Tang, S.; Black, C.L.; Hartnett, K.P.; Kite-Powell, A.; Dietz, S.; Lozier, M.; et al. Changing Age Distribution of the COVID-19 Pandemic—United States, May–August 2020. Morb. Mortal. Wkly. Rep. 2020, 69, 1404–1409. [Google Scholar] [CrossRef]
- Dong, Y.; Mo, X.; Hu, Y.; Qi, X.; Jiang, F.; Jiang, Z.; Tong, S. Epidemiology of COVID-19 among Children in China. Pediatrics 2020, 145, e20200702. [Google Scholar] [CrossRef]
- Biesbroek, G.; Kapitein, B.; Kuipers, I.M.; Gruppen, M.P.; van Stijn, D.; Peros, T.E.; van Veenendaal, M.; Jansen, M.H.A.; van der Zee, C.W.; van der Kuip, M.; et al. Inflammatory responses in SARS-CoV-2 associated Multisystem Inflammatory Syndrome and Kawasaki Disease in children: An observational study. PLoS ONE 2022, 17, e0266336. [Google Scholar] [CrossRef]
- Verdoni, L.; Mazza, A.; Gervasoni, A.; Martelli, L.; Ruggeri, M.; Ciuffreda, M.; Bonanomi, E.; D’Antiga, L. An outbreak of severe Kawasaki-like disease at the Italian epicentre of the SARS-CoV-2 epidemic: An observational cohort study. Lancet 2020, 395, 1771–1778. [Google Scholar] [CrossRef]
- Jones, V.G.; Mills, M.; Suarez, D.; Hogan, C.A.; Yeh, D.; Segal, J.B.; Nguyen, E.L.; Barsh, G.R.; Maskatia, S.; Mathew, R. COVID-19 and Kawasaki Disease: Novel Virus and Novel Case. Hosp. Pediatr. 2020, 10, 537–540. [Google Scholar] [CrossRef] [PubMed]
- Folga, B.A.; Karpenko, C.J.; Grygiel-Górniak, B. SARS-CoV-2 infection in the context of Kawasaki disease and multisystem inflammatory syndrome in children. Med. Microbiol. Immunol. 2023, 212, 3–12. [Google Scholar] [CrossRef]
- Jiang, L.; Tang, K.; Irfan, O.; Li, X.; Zhang, E.; Bhutta, Z. Epidemiology, Clinical Features, and Outcomes of Multisystem Inflammatory Syndrome in Children (MIS-C) and Adolescents-a Live Systematic Review and Meta-analysis. Curr. Pediatr. Rep. 2022, 10, 19–30. [Google Scholar] [CrossRef]
- Toubiana, J.; Levy, C.; Allali, S.; Jung, C.; Leruez-Ville, M.; Varon, E.; Bajolle, F.; Ouldali, N.; Chareyre, J.; Béchet, S.; et al. Association between SARS-CoV-2 infection and Kawasaki-like multisystem inflammatory syndrome: A retrospective matched case-control study, Paris, France, April to May 2020. Eurosurveillance 2020, 25, 2001813. [Google Scholar] [CrossRef]
- Whittaker, E.; Bamford, A.; Kenny, J.; Kaforou, M.; Jones, C.E.; Shah, P.; Ramnarayan, P.; Fraisse, A.; Miller, O.; Davies, P.; et al. Clinical Characteristics of 58 Children With a Pediatric Inflammatory Multisystem Syndrome Temporally Associated With SARS-CoV-2. JAMA 2020, 324, 259–269. [Google Scholar] [CrossRef] [PubMed]
- Henderson, L.A.; Canna, S.W.; Friedman, K.G.; Gorelik, M.; Lapidus, S.K.; Bassiri, H.; Behrens, E.M.; Kernan, K.F.; Schulert, G.S.; Seo, P.; et al. American College of Rheumatology Clinical Guidance for Multisystem Inflammatory Syndrome in Children Associated With SARS-CoV-2 and Hyperinflammation in Pediatric COVID-19: Version 3. Arthritis Rheumatol. 2022, 74, e1–e20. [Google Scholar] [CrossRef]
- Patel, J.M. Multisystem Inflammatory Syndrome in Children (MIS-C). Curr. Allergy Asthma Rep. 2022, 22, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Balestrieri, E.; Minutolo, A.; Petrone, V.; Fanelli, M.; Iannetta, M.; Malagnino, V.; Zordan, M.; Vitale, P.; Charvet, B.; Horvat, B.; et al. Evidence of the pathogenic HERV-W envelope expression in T lymphocytes in association with the respiratory outcome of COVID-19 patients. EBioMedicine 2021, 66, 103341. [Google Scholar] [CrossRef]
- Tovo, P.A.; Garazzino, S.; Daprà, V.; Pruccoli, G.; Calvi, C.; Mignone, F.; Alliaudi, C.; Denina, M.; Scolfaro, C.; Zoppo, M.; et al. COVID-19 in Children: Expressions of Type I/II/III Interferons, TRIM28, SETDB1, and Endogenous Retroviruses in Mild and Severe Cases. Int. J. Mol. Sci. 2021, 22, 7481. [Google Scholar] [CrossRef] [PubMed]
- Johnson, W.E. Origins and evolutionary consequences of ancient endogenous retroviruses. Nat. Rev. Microbiol. 2019, 17, 355–370. [Google Scholar] [CrossRef] [PubMed]
- Bock, M.; Stoye, J.P. Endogenous retroviruses and the human germline. Curr. Opin. Genet. Dev. 2000, 10, 651–655. [Google Scholar] [CrossRef]
- Thomas, J.; Perron, H.; Feschotte, C. Variation in proviral content among human genomes mediated by LTR recombination. Mob. DNA 2018, 9, 36. [Google Scholar] [CrossRef] [PubMed]
- Ehlhardt, S.; Seifert, M.; Schneider, J.; Ojak, A.; Zang, K.D.; Mehraein, Y. Human endogenous retrovirus HERV-K(HML-2) Rec expression and transcriptional activities in normal and rheumatoid arthritis synovia. J. Rheumatol. 2006, 33, 16–23. [Google Scholar] [CrossRef] [PubMed]
- Mi, S.; Lee, X.; Li, X.; Veldman, G.M.; Finnerty, H.; Racie, L.; LaVallie, E.; Tang, X.Y.; Edouard, P.; Howes, S.; et al. Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 2000, 403, 785–789. [Google Scholar] [CrossRef]
- Chuong, E.B.; Elde, N.C.; Feschotte, C. Regulatory evolution of innate immunity through co-option of endogenous retroviruses. Science 2016, 351, 1083–1087. [Google Scholar] [CrossRef] [PubMed]
- Frendo, J.L.; Olivier, D.; Cheynet, V.; Blond, J.L.; Bouton, O.; Vidaud, M.; Rabreau, M.; Evain-Brion, D.; Mallet, F. Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Mol. Cell. Biol. 2003, 23, 3566–3574. [Google Scholar] [CrossRef]
- Russ, E.; Iordanskiy, S. Endogenous Retroviruses as Modulators of Innate Immunity. Pathogens 2023, 12, 162. [Google Scholar] [CrossRef]
- Rolland, A.; Jouvin-Marche, E.; Viret, C.; Faure, M.; Perron, H.; Marche, P.N. The envelope protein of a human endogenous retrovirus-W family activates innate immunity through CD14/TLR4 and promotes Th1-like responses. J. Immunol. 2006, 176, 7636–7644. [Google Scholar] [CrossRef]
- Hurst, T.P.; Magiorkinis, G. Activation of the innate immune response by endogenous retroviruses. J. Gen. Virol. 2015, 96, 2470. [Google Scholar] [CrossRef]
- Hurst, T.P.; Magiorkinis, G. Epigenetic Control of Human Endogenous Retrovirus Expression: Focus on Regulation of Long-Terminal Repeats (LTRs). Viruses 2017, 9, 130. [Google Scholar] [CrossRef] [PubMed]
- Manghera, M.; Douville, R.N. Endogenous retrovirus-K promoter: A landing strip for inflammatory transcription factors? Retrovirology 2013, 10, 16. [Google Scholar] [CrossRef] [PubMed]
- Johnston, J.B.; Silva, C.; Holden, J.; Warren, K.G.; Clark, A.W.; Power, C. Monocyte activation and differentiation augment human endogenous retrovirus expression: Implications for inflammatory brain diseases. Ann. Neurol. 2001, 50, 434–442. [Google Scholar] [CrossRef] [PubMed]
- Gruchot, J.; Herrero, F.; Weber-Stadlbauer, U.; Meyer, U.; Küry, P. Interplay between activation of endogenous retroviruses and inflammation as common pathogenic mechanism in neurological and psychiatric disorders. Brain Behav. Immun. 2023, 107, 242–252. [Google Scholar] [CrossRef]
- Balestrieri, E.; Matteucci, C.; Cipriani, C.; Grelli, S.; Ricceri, L.; Calamandrei, G.; Vallebona, P.S. Endogenous Retroviruses Activity as a Molecular Signature of Neurodevelopmental Disorders. Int. J. Mol. Sci. 2019, 20, 6050. [Google Scholar] [CrossRef]
- Matteucci, C.; Balestrieri, E.; Argaw-Denboba, A.; Sinibaldi-Vallebona, P. Human endogenous retroviruses role in cancer cell stemness. Semin. Cancer Biol. 2018, 53, 17–30. [Google Scholar] [CrossRef]
- Temerozo, J.R.; Fintelman-Rodrigues, N.; Dos Santos, M.C.; Hottz, E.D.; Sacramento, C.Q.; de Paula Dias da Silva, A.; Mandacaru, S.C.; Dos Santos Moraes, E.C.; Trugilho, M.R.O.; Gesto, J.S.M.; et al. Human endogenous retrovirus K in the respiratory tract is associated with COVID-19 physiopathology. Microbiome 2022, 10, 65. [Google Scholar] [CrossRef]
- Petrone, V.; Fanelli, M.; Giudice, M.; Toschi, N.; Conti, A.; Maracchioni, C.; Iannetta, M.; Resta, C.; Cipriani, C.; Miele, M.T.; et al. Expression Profile of HERVs And Inflammatory Mediators Detected In Nasal Mucosa As a Predictive Biomarker of COVID-19 Severity. Front. Microbiol. 2023, 14, 1155624. [Google Scholar] [CrossRef]
- Liang, C.Y.; Wang, L.J.; Chen, C.P.; Chen, L.F.; Chen, Y.H.; Chen, H. GCM1 regulation of the expression of syncytin 2 and its cognate receptor MFSD2A in human placenta. Biol. Reprod. 2010, 83, 387–895. [Google Scholar] [CrossRef] [PubMed]
- Zhu, H.; Peng, B.; Klausen, C.; Yi, Y.; Li, Y.; Xiong, S.; von Dadelszen, P.; Leung, P.C.K. NPFF increases fusogenic proteins syncytin 1 and syncytin 2 via GCM1 in first trimester primary human cytotrophoblast cells. FASEB J. 2020, 34, 9419–9432. [Google Scholar] [CrossRef] [PubMed]
- Roberts, R.M.; Ezashi, T.; Schulz, L.C.; Sugimoto, J.; Schust, D.J.; Khan, T.; Zhou, J. Syncytins expressed in human placental trophoblast. Placenta 2021, 113, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Mangeney, M.; Renard, M.; Schlecht-Louf, G.; Bouallaga, I.; Heidmann, O.; Letzelter, C.; Richaud, A.; Ducos, B.; Heidmann, T. Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proc. Natl. Acad. Sci. USA 2007, 104, 20534–20539. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Yang, C.; Liu, Y.; Li, T.; Li, H.; Han, J.; Jia, L.; Wang, X.; Zhang, B.; Li, J.; et al. High Expression of HERV-K (HML-2) Might Stimulate Interferon in COVID-19 Patients. Viruses 2022, 14, 996. [Google Scholar] [CrossRef] [PubMed]
- Fabi, M.; Petrovic, B.; Andreozzi, L.; Corinaldesi, E.; Filice, E.; Biagi, C.; Rizzello, A.; Mattesini, B.E.; Bugani, S.; Lanari, M. Circulating Endothelial Cells: A New Possible Marker of Endothelial Damage in Kawasaki Disease, Multisystem Inflammatory Syndrome in Children and Acute SARS-CoV-2 Infection. Int. J. Mol. Sci. 2022, 23, 10106. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.H.; Li, S.C.; Huang, L.H.; Chen, P.C.; Lin, Y.Y.; Lin, C.C.; Kuo, H.C. Identifying genetic hypomethylation and upregulation of Toll-like receptors in Kawasaki disease. Oncotarget 2017, 8, 11249–11258. [Google Scholar] [CrossRef]
- Mabrey, F.L.; Morrell, E.D.; Wurfel, M.M. TLRs in COVID-19: How they drive immunopathology and the rationale for modulation. Innate Immun. 2021, 27, 503–513. [Google Scholar] [CrossRef]
- Amati, F.; Vancheri, C.; Latini, A.; Colona, V.L.; Grelli, S.; D’Apice, M.R.; Balestrieri, E.; Passarelli, C.; Minutolo, A.; Loddo, S.; et al. Expression profiles of the SARS-CoV-2 host invasion genes in nasopharyngeal and oropharyngeal swabs of COVID-19 patients. Heliyon 2020, 6, e05143. [Google Scholar] [CrossRef]
- Orlov, M.; Wander, P.L.; Morrell, E.D.; Mikacenic, C.; Wurfel, M.M. A Case for Targeting Th17 Cells and IL-17A in SARS-CoV-2 Infections. J. Immunol. 2020, 205, 892–898. [Google Scholar] [CrossRef]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef]
- Tan, M.; Liu, Y.; Zhou, R.; Deng, X.; Li, F.; Liang, K.; Shi, Y. Immunopathological characteristics of coronavirus disease 2019 cases in Guangzhou, China. Immunology 2020, 160, 261–268. [Google Scholar] [CrossRef]
- McMurray, J.C.; May, J.W.; Cunningham, M.W.; Jones, O.Y. Multisystem Inflammatory Syndrome in Children (MIS-C), a Post-viral Myocarditis and Systemic Vasculitis-A Critical Review of Its Pathogenesis and Treatment. Front. Pediatr. 2020, 8, 626182. [Google Scholar] [CrossRef]
- Grandi, N.; Tramontano, E. Human Endogenous Retroviruses Are Ancient Acquired Elements Still Shaping Innate Immune Responses. Front. Immunol. 2018, 9, 2039. [Google Scholar] [CrossRef] [PubMed]
- Perron, H.; Lang, A. The human endogenous retrovirus link between genes and environment in multiple sclerosis and in multifactorial diseases associating neuroinflammation. Clin. Rev. Allergy Immunol. 2010, 39, 51–61. [Google Scholar] [CrossRef] [PubMed]
- Charvet, B.; Brunel, J.; Pierquin, J.; Iampietro, M.; Decimo, D.; Queruel, N.; Lucas, A.; Encabo-Berzosa, M.D.M.; Arenaz, I.; Marmolejo, T.P.; et al. SARS-CoV-2 awakens ancient retroviral genes and the expression of proinflammatory HERV-W envelope protein in COVID-19 patients. iScience 2023, 5, 106604. [Google Scholar] [CrossRef]
- Tarlinton, R.E.; Martynova, E.; Rizvanov, A.A.; Khaiboullina, S.; Verma, S. Role of Viruses in the Pathogenesis of Multiple Sclerosis. Viruses 2020, 12, 643. [Google Scholar] [CrossRef] [PubMed]
- Morozov, V.A.; Dao Thi, V.L.; Denner, J. The transmembrane protein of the human endogenous retrovirus--K (HERV-K) modulates cytokine release and gene expression. PLoS ONE 2013, 8, e70399. [Google Scholar] [CrossRef]
- Greenig, M. HERVs, immunity, and autoimmunity: Understanding the connection. PeerJ 2019, 7, e6711. [Google Scholar] [CrossRef]
- Levet, S.; Charvet, B.; Bertin, A.; Deschaumes, A.; Perron, H.; Hober, D. Human Endogenous Retroviruses and Type 1 Diabetes. Curr. Diabetes Rep. 2019, 19, 141. [Google Scholar] [CrossRef]
- Perron, H.; Mekaoui, L.; Bernard, C.; Veas, F.; Stefas, I.; Leboyer, M. Endogenous retrovirus type W GAG and envelope protein antigenemia in serum of schizophrenic patients. Biol. Psychiatry 2008, 64, 1019–1023. [Google Scholar] [CrossRef]
- World Health Organization. Multisystem Inflammatory Syndrome in Children and Adolescents with COVID-19. Available online: https://www.who.int/publications/i/item/multisystem-inflammatory-syndrome-in-children-and-adolescents-with-covid-19 (accessed on 6 August 2023).
- Balestrieri, E.; Cipriani, C.; Matteucci, C.; Benvenuto, A.; Coniglio, A.; Argaw-Denboba, A.; Toschi, N.; Bucci, I.; Miele, M.T.; Grelli, S.; et al. Children with Autism Spectrum Disorder and Their Mothers Share Abnormal Expression of Selected Endogenous Retroviruses Families and Cytokines. Front. Immunol. 2019, 10, 2244. [Google Scholar] [CrossRef]
- Cipriani, C.; Giudice, M.; Petrone, V.; Fanelli, M.; Minutolo, A.; Miele, M.T.; Toschi, N.; Maracchioni, C.; Siracusano, M.; Benvenuto, A.; et al. Modulation of human endogenous retroviruses and cytokines expression in peripheral blood mononuclear cells from autistic children and their parents. Retrovirology 2022, 19, 26. [Google Scholar] [CrossRef]
- Levet, S.; Medina, J.; Joanou, J.; Demolder, A.; Queruel, N.; Réant, K.; Normand, M.; Seffals, M.; Dimier, J.; Germi, R.; et al. An ancestral retroviral protein identified as a therapeutic target in type-1 diabetes. JCI Insight 2017, 2, e94387. [Google Scholar] [CrossRef] [PubMed]
- Mameli, G.; Poddighe, L.; Astone, V.; Delogu, G.; Arru, G.; Sotgiu, S.; Serra, C.; Dolei, A. Novel reliable real-time PCR for differential detection of MSRVenv and syncytin-1 in RNA and DNA from patients with multiple sclerosis. J. Virol. Methods 2009, 161, 98–106. [Google Scholar] [CrossRef]
- Available online: https://pga.mgh.harvard.edu/primerbank/ (accessed on 6 August 2023).
- Zhou, G.; Qin, M.; Zhang, X.; Yang, J.; Yu, H. Topotecan induces hepatocellular injury via ASCT2 mediated oxidative stress. Gastroenterol. Hepatol. 2021, 44, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Malassiné, A.; Frendo, J.L.; Blaise, S.; Handschuh, K.; Gerbaud, P.; Tsatsaris, V.; Heidmann, T.; Evain-Brion, D. Human endogenous retrovirus-FRD envelope protein (syncytin 2) expression in normal and trisomy 21-affected placenta. Retrovirology 2008, 5, 6. [Google Scholar] [CrossRef] [PubMed]
- Toufaily, C.; Vargas, A.; Lemire, M.; Lafond, J.; Rassart, E.; Barbeau, B. MFSD2a, the Syncytin-2 receptor, is important for trophoblast fusion. Placenta 2013, 34, 85–88. [Google Scholar] [CrossRef]
- Available online: https://www.neair.org/docs/2004_neair_conference_procee.pdf#page=47 (accessed on 6 August 2023).
KD | MIS-C | COV | HCs | |
---|---|---|---|---|
Number of children | 8 | 17 | 10 | 19 |
Male n. | 2 | 11 | 8 | 11 |
Male/Female ratio | 0.25 | 0.65 | 0.8 | 0.58 |
Median age (IQR) * | 110 (17–152) | 68 (47–105) | 33.5 (12.5–80.75) | 48 (16–96) |
Clinical Manifestations | ||
---|---|---|
KD (n = 8) | MIS-C (n = 17) | |
Respiratory symptoms, n (%) | 1 (12.5%) | 4 (23.5%) |
Conjunctival hyperaemia, n (%) | 8 (100%) | 12 (70.6%) |
Extremity changes, n (%) | 3 (37.5%) | 6 (35.3%) |
Skin rash, n (%) | 8 (100.0%) | 10 (58.8%) |
Oral changes, n (%) | 5 (62.5%) | 9 (52.9%) |
Cervical lymphadenopathy, n (%) | 6 (75.0%) | 3 (17.6%) |
Abdominal involvement, n (%) | 5 (62.5%) | 14 (82.4%) |
Hypotension, n (%) | 0 (0%) | 9 (64.7%) |
Day of standard treatment, median (IQR) | 6.5 (4.7–8.00) | 5 (4.0–6.25) |
Nonresponders, n (%) | 2 (25.0%) | 3 (17.6%) |
Coronary artery involvement | ||
Acute phase | ||
CALs, n (%) | 1 (12.5%) | 5 (29.4%) |
Subacute phase | ||
CALs, n (%) | 1 (12.5%) | 2 (11.8%) |
Laboratory values | ||
Acute phase | ||
WBC × 109/L, median (IQR) | 14.6 (13.8–16.4) | 9.1 (5.8–14.7) |
N%, median (IQR) | 71.4 (69.9–79.2) | 78.0 (74.1–84.5) |
L%, median (IQR) | 18.9 (12.8–22.1) | 13.0 (10.8–20.3) |
E%, median (IQR) | 0.7 (0.5–1.4) | 0.3 (0.1–2.0) |
NLR, median (IQR) | 4.1 (3.2–6.3) | 5.8 (3.7–7.6) |
RBC × 1012/L, median (IQR) | 4.2 (4.1–4.8) | 4.0 (3.9–4.3) |
Hb g/dL, median (IQR) | 11.8 (11.0–11.9) | 10.9 (10.5–11.6) |
PLT × 109/L, median (IQR) | 344 (329–397) | 161 (129–289) |
CRP mg/dL, median (IQR) | 11.5 (6.3–16.4) | 17.7 (12.8–23.1) |
Albumin g/dL, median (IQR) | 3.7 (3.5–4.0) | 3.1 (3.0–3.8) |
Sodium mmol/L, median (IQR) | 135 (133–138) | 134 (131–136) |
ALT IU/L, median (IQR) | 24 (19–162) | 29 (21–50) |
Troponin ng/mL, median (IQR) | 5.7 (4.0–7.75) | 84.2 (11.3–124.1) |
BNP ng/L, median (IQR) | 139.0 (132.0–154.0) | 481.5 (238.3–1437.3) |
Subacute phase | ||
WBC × 109/L, median (IQR) | 12.2 (9.8–14.8) | 10.7 (12.6–15.7) |
N%, median (IQR) | 36.7 (26.1–50.3) | 62.6 (53.0–75.4) |
L%, median (IQR) | 47.5 (36.2- 60.1) | 24.7 (19.1–36.6) |
E%, median (IQR) | 2.9 (0.9–5.2) | 0.2 (0.1–0.5) |
NLR, median (IQR) | 0.9 (0.5–1.1) | 2.4 (1.5–4.0) |
RBC × 1012/L, median (IQR) | 3.9 (3.7–4.4) | 4.2 (3.8–4.3) |
Hb g/dL, median (IQR) | 10.9 (9.9–12.2) | 11.2 (10.2–11.8) |
PLT × 109/L, median (IQR) | 649 (479–790) | 419 (285–550) |
CRP mg/dL, median (IQR) | 0.7 (0.3–1.1) | 1.4 (0.5–1.7) |
Albumin g/dL, median (IQR) | 3.4 (3.0–3.6) | 3.9 (3.5–4.3) |
Sodium mmol/L, median (IQR) | 139 (137–140) | 139 (137–141) |
ALT IU/L, median (IQR) | 22 (17–42) | 43 (25–60) |
Gene | Forward Primers (5′→3′) | Reverse Primers (5′→3′) | Ref. | |
---|---|---|---|---|
HERV-W | AF331500 | GTATGTCTGATGGGGGTGGAG | CTAGTCCTTTGTAGGGGCTAGAG | [62] |
HERV-K | AF1646 | GCCATCCACCAAGAAAGCA | AACTGCGTCAGCTCTTTAGTTGT | [60] |
Syn-1 | NM_001130925.2 | ACTTTGTCTCTTCCAGAATCG | GCGGTAGATCTTAGTCTTGG | [63] |
ASCT-1 | NM_001193493.2 | CTGGTGTTAGGAGTGGCCTT | GGTCGCTGAGCACATAATCCA | [64] |
ASCT-2 | NM_001145144.2 | TCCTCTTCACCCGCAAAAACC | CCACGCCATTATTCTCCTCCAC | [65] |
Syn-2 | NM_207582.3 | GCCTGCAAATAGTCTTCTTT | ATAGGGGCTATTCCCATTAG | [66] |
MFSD2A | NM_001136493.3 | CTCCTGGCCATCATGCTCTC | GGCCACCAAGATGAGAAA | [67] |
IL-1β | NM_000576.2 | CCACCTCCAGGGACAGGATA | AACACGCAGGACAGGTACAG | [60] |
IL-6 | NM_000600.3 | TGCAATAACCACCCCTGACC | ATTTGCCGAAGAGCCCTCAG | [60] |
IL-10 | NM_000572.2 | ACATCAAGGCGCATGTGAAC | CACGGCCTTGCTCTTGTTTT | [60] |
TNF-α | NM_000594.3 | CCCGAGTGACAAGCCTGTAG | TGAGGTACAGGCCCTCTGAT | [60] |
MCP-1 | NM_002982.4 | AGAATCACCAGCAGCAAGTGTCC | TCCTGAACCCACTTCTGCTTGG | [18] |
INF-γ | NM_000619.2 | TCAGCTCTGCATCGTTTTGG | GTTCCATTATCCGCTACATCTGAA | [60] |
TLR-3 | NM_003265.3 | GCGCTAAAAAGTGAAGAACTGGAT | GCTGGACATTGTTCAGAAAGAGG | [64] |
TLR-4 | NM_003266.4 | CCCTGAGGCATTTAGGCAGCTA | AGGTAGAGAGGTGGCTTAGGCT | [64] |
TLR-9 | NM_017442 | TGC CCA AAC TGG AAG TCC TC | TAA GGT TGA GCT CTC GCA GC | [64] |
GAPDH | NM_001256799.3 | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA | [64] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Balestrieri, E.; Corinaldesi, E.; Fabi, M.; Cipriani, C.; Giudice, M.; Conti, A.; Minutolo, A.; Petrone, V.; Fanelli, M.; Miele, M.T.; et al. Preliminary Evidence of the Differential Expression of Human Endogenous Retroviruses in Kawasaki Disease and SARS-CoV-2-Associated Multisystem Inflammatory Syndrome in Children. Int. J. Mol. Sci. 2023, 24, 15086. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242015086
Balestrieri E, Corinaldesi E, Fabi M, Cipriani C, Giudice M, Conti A, Minutolo A, Petrone V, Fanelli M, Miele MT, et al. Preliminary Evidence of the Differential Expression of Human Endogenous Retroviruses in Kawasaki Disease and SARS-CoV-2-Associated Multisystem Inflammatory Syndrome in Children. International Journal of Molecular Sciences. 2023; 24(20):15086. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242015086
Chicago/Turabian StyleBalestrieri, Emanuela, Elena Corinaldesi, Marianna Fabi, Chiara Cipriani, Martina Giudice, Allegra Conti, Antonella Minutolo, Vita Petrone, Marialaura Fanelli, Martino Tony Miele, and et al. 2023. "Preliminary Evidence of the Differential Expression of Human Endogenous Retroviruses in Kawasaki Disease and SARS-CoV-2-Associated Multisystem Inflammatory Syndrome in Children" International Journal of Molecular Sciences 24, no. 20: 15086. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms242015086