Cyt-C Mediated Mitochondrial Pathway Plays an Important Role in Oocyte Apoptosis in Ricefield Eel (Monopterus albus)
Abstract
:1. Introduction
2. Results
2.1. Apoptosis Rates in Gonads at Different Developmental Stages
2.2. Relative Content of Apoptotic Proteins
2.3. Expression Pattern of Apoptotic Genes in the Gonads at Different Developmental Stages
2.4. Immunolocalization of Cyt-C in the Gonads
2.5. Effect of H2O2 on Gonadal Apoptosis
3. Discussion
4. Materials and Methods
4.1. Ethical Statement
4.2. Experimental Animals
4.3. Developmental Stage Identification
4.4. Apoptosis Analysis
4.5. Determination of Relative Content of Apoptotic Proteins
4.6. RNA Isolation and Quantitative RT-PCR (qRT-PCR)
4.7. Immunohistochemistry
4.8. H2O2 Incubation In Vitro
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bosco, L.; Ruvolo, G.; Morici, G.; Manno, M.; Cittadini, E.; Roccheri, M.C. Apoptosis in human unfertilized oocytes after intracytoplasmic sperm injection. Fertil. Steril. 2005, 84, 1417–1423. [Google Scholar] [CrossRef] [PubMed]
- Yadav, P.K.; Tiwari, M.; Gupta, A.; Sharma, A.; Prasad, S.; Pandey, A.N.; Chaube, S.K. Germ cell depletion from mammalian ovary: Possible involvement of apoptosis and autophagy. J. Biomed. Sci. 2018, 25, 36. [Google Scholar] [CrossRef] [PubMed]
- Tiwari, M.; Prasad, S.; Tripathi, A.; Pandey, A.N.; Ali, I.; Singh, A.K.; Shrivastav, T.G.; Chaube, S.K. Apoptosis in mammalian oocytes: A review. Apoptosis 2015, 20, 1019–1025. [Google Scholar] [CrossRef] [PubMed]
- Jablonska, O.; Juchno, D.; Leska, A.; Kowalewska, K. The variable presence of apoptosis in the testes of diploid and sterile allotetraploid Cobitis (Teleostei, Cobitidae) males during reproductive cycle. J. Exp. Biol. 2020, 223, jeb212050. [Google Scholar] [CrossRef]
- Ribeiro, Y.M.; de Matos, S.A.; Domingos, F.F.T.; Dos Santos, H.B.; Bicalho, A.; Vieira, C.; Bazzoli, N.; Rizzo, E. Germ cell proliferation and apoptosis during testicular regression in a seasonal breeding fish kept in captivity. Tissue Cell 2017, 49, 664–671. [Google Scholar] [CrossRef]
- Wood, A.W.; Kraak, G.V.D. Inhibition of apoptosis in vitellogenic ovarian follicles of rainbow trout (Oncorhynchus mykiss) by salmon gonadotropin, epidermal growth factor, and 17β-estradiol. Mol. Reprod. Dev. 2002, 61, 511–518. [Google Scholar] [CrossRef]
- Mokhtar, D.M.; Hussein, M. Microanalysis of Fish Ovarian Follicular Atresia: A Possible Synergic Action of Somatic and Immune Cells. Microsc. Microanal. 2020, 26, 599–608. [Google Scholar] [CrossRef]
- Sales, C.F.; Melo, R.M.C.; Pinheiro, A.P.B.; Luz, R.K.; Rizzo, E. Autophagy and Cathepsin D mediated apoptosis contributing to ovarian follicular atresia in the Nile tilapia. Mol. Reprod. Dev. 2019, 86, 1592–1602. [Google Scholar] [CrossRef]
- Rodríguez-Marí, A.; Cañestro, C.; Bremiller, R.A.; Nguyen-Johnson, A.; Asakawa, K.; Kawakami, K.; Postlethwait, J.H. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis. PLoS Genet. 2010, 6, e1001034. [Google Scholar] [CrossRef]
- Thomé, R.; Domingos, F.; Santos, H.B.; Martinelli, P.M.; Sato, Y.; Rizzo, E.; Bazzoli, N. Apoptosis, cell proliferation and vitellogenesis during the folliculogenesis and follicular growth in teleost fish. Tissue Cell 2012, 44, 54–62. [Google Scholar] [CrossRef]
- Ryo, N.; Ryo, H.; Ryosuke, M.; Yasuhisa, K.; Masaru, N. Survival of ovarian somatic cells during sex change in the protogynous wrasse, Halichoeres trimaculatus. Fish Physiol. Biochem. 2013, 39, 47–51. [Google Scholar]
- Uchida, D.; Yamashita, M.; Kitano, T.; Iguchi, T. Oocyte apoptosis during the transition from ovary-like tissue to testes during sex differentiation of juvenile zebrafish. J. Exp. Biol. 2002, 205, 711–718. [Google Scholar] [CrossRef] [PubMed]
- Uchida, D.; Yamashita, M.; Kitano, T.; Iguchi, T. An aromatase inhibitor or high water temperature induce oocyte apoptosis and depletion of P450 aromatase activity in the gonads of genetic female zebrafish during sex-reversal. Comp. Biochem. Physiol. 2004, 137, 11–20. [Google Scholar] [CrossRef]
- Zhou, Z.; Zhou, B.; Chen, H.; Tang, X.; Wang, Y. Reactive oxygen species (ROS) and the calcium-(Ca2+) mediated extrinsic and intrinsic pathways underlying BDE-47-induced apoptosis in rainbow trout (Oncorhynchus mykiss) gonadal cells. Sci. Total Environt. 2019, 15, 778–788. [Google Scholar] [CrossRef]
- Bridgham, J.; Wilder, J.; Hollocher, H.; Johnson, A. All in the family: Evolutionary and functional relationships among death receptors. Cell Death Differ. 2003, 10, 19–25. [Google Scholar] [CrossRef]
- Redza-Dutordoir, M.; Averill-Bates, D.A. Activation of apoptosis signaling pathways by reactive oxygen species. Biochim. Biophys. Acta-Mol. Cell Res. 2018, 1863, 2977–2992. [Google Scholar] [CrossRef]
- Zhao, S.; Yuan, C.; Tuo, X.; Zhou, C.; Zhao, Q.; Shen, T. MCLR induces dysregulation of calcium homeostasis and endoplasmic reticulum stress resulting in apoptosis in Sertoli cells. Chemosphere 2020, 263, 127868. [Google Scholar] [CrossRef]
- Giamogante, F.; Poggio, E.; Barazzuol, L.; Covallero, A.; Calì, T. Apoptotic signals at the endoplasmic reticulum-mitochondria interface. Adv. Protein Chem. Struct. Biol. 2021, 126, 307–343. [Google Scholar]
- Kawamura, K.; Fukuda, J.; Kodama, H.; Kumagai, J.; Kumagai, A.; Tanaka, T. Expression of Fas and Fas ligand mRNA in rat and human preimplantation embryos. Mol. Hum. Reprod. 2001, 7, 431–436. [Google Scholar] [CrossRef]
- Fu, X.; Cui, J.; Meng, X.; Jiang, P.; Zheng, Q.; Zhao, W.; Chen, X. Endoplasmic reticulum stress, cell death and tumor: Association between endoplasmic reticulum stress and the apoptosis pathway in tumors (Review). Oncol. Rep. 2021, 45, 801–808. [Google Scholar] [CrossRef]
- Shakeri, R.; Kheirollahi, A.; Davoodi, J. Apaf-1: Regulation and function in cell death. Biochimie (Paris) 2017, 135, 111–125. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zhu, J.; Jiang, L.; Shan, B.; Xiao, P.; Ai, J.; Li, N.; Qi, F.; Niu, S. Mechanism of Heshouwuyin inhibiting the Cyt c/Apaf-1/Caspase-9/Caspase-3 pathway in spermatogenic cell apoptosis. BMC Complement. Altern. Med. 2020, 20, 180. [Google Scholar] [CrossRef] [PubMed]
- Zuo, S.; Kong, D.; Wang, C.; Liu, J.; Wang, Y.; Wan, Q.; Yan, S.; Zhang, J.; Tang, J.; Zhang, Q.; et al. CRTH2 promotes endoplasmic reticulum stress-induced cardiomyocyte apoptosis through m-calpain. EMBO Mol. Med. 2018, 10, e8237. [Google Scholar] [CrossRef]
- Song, Z.; Zhang, Y.; Zhang, H.; Rajendran, R.S.; Wang, R.; Hsiao, C.-D.; Li, J.; Xia, Q.; Liu, K. Isoliquiritigenin triggers developmental toxicity and oxidative stress-mediated apoptosis in zebrafish embryos/larvae via Nrf2-HO1/JNK-ERK/mitochondrion pathway. Chemosphere 2020, 246, 125727. [Google Scholar] [CrossRef] [PubMed]
- Zhan, C.; Liu, W.; Zhang, F.; Zhang, X. Microcystin-LR triggers different endoplasmic reticulum stress pathways in the liver, ovary, and offspring of zebrafish (Danio rerio). J. Hazrd. Mater. 2020, 386, 121939. [Google Scholar] [CrossRef] [PubMed]
- Luzio, A.; Matos, M.; Santos, D.; Fontaínhas-Fernandes, A.A.; Monteiro, S.M.; Coimbra, A.M. Disruption of apoptosis pathways involved in zebrafish gonad differentiation by 17α-ethinylestradiol and fadrozole exposures. Aquat. Toxicol. 2016, 177, 269–284. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Z.; Chen, H.; Li, Y.; Liu, Q.; Lu, K.; Zhu, X.; Wang, Y. Transcriptome and biochemical analyses of rainbow trout (Oncorhynchus mykiss) RTG-2 gonadal cells in response to BDE-47 stress indicates effects on cell proliferation. Aquat. Toxicol. 2022, 245, 106108. [Google Scholar] [CrossRef]
- Sun, J.; Wang, S.; Cao, Y.; Wang, S.; Li, S. Cadmium exposure induces apoptosis, inflammation and immunosuppression through CYPs activation and antioxidant dysfunction in common carp neutrophils. Fish Shellfish. Immunol 2020, 99, 284–290. [Google Scholar]
- Liu, C.K. Rudimentary hermaphroditism in the symbranchoid eel, Monopterus javanensis. Sinensia 1944, 15, 1–8. [Google Scholar]
- He, Z.; Deng, F.; Ma, Z.; Zhang, Q.; He, J.; Ye, L.; Chen, H.; Yang, D.; He, L.; Luo, J.; et al. Molecular characterization, expression, and H2O2 induction of p53 and mdm2 in the ricefield eel. Monopterus Albus. Aquac. Rep. 2021, 20, 100675. [Google Scholar] [CrossRef]
- He, Z.; Deng, F.; Ma, Z.; Zhang, Q.; He, J.; Ye, L.; Chen, H.; Yang, D.; He, L.; Luo, J.; et al. Molecular characterization, expression, and apoptosis regulation of siva1 in protogynous hermaphrodite fish ricefield eel (Monopterus albus). Fish Physiol. Biochem. 2021, 47, 1585–1596. [Google Scholar] [CrossRef] [PubMed]
- He, Z.; He, Z.; He, L.; Ruan, H.; Li, S.; Yan, T. Expression and localization of Caspase-3 in Monopterus albus gonad during natural sex reversal (in Chinese). Freshwater Fish. 2019, 49, 8–13. [Google Scholar]
- Shi, Y.; Zhong, L.; Chen, K.; Fan, Y.; Xie, K.; Zhang, J. Sanguinarine attenuates hydrogen peroxide-induced toxicity in liver of Monopterus albus: Role of oxidative stress, inflammation and apoptosis. Fish Shellfish Immun. 2022, 125, 190–199. [Google Scholar] [CrossRef] [PubMed]
- Thomas, J.T.; Todd, E.V.; Muncaster, S.; Lokman, P.M.; Damsteegt, E.L.; Liu, H.; Soyano, K.; Gléonnec, F.; Lamm, M.S.; Godwin, J.R.; et al. Conservation and diversity in expression of candidate genes regulating socially-induced female-male sex change in wrasses. PeerJ 2019, 7, e7032. [Google Scholar] [CrossRef]
- Wu, G.-C.; Chang, C.-F. Oocytes Survive in the Testis By Altering the Soma Fate from Male to Female in the Protandrous Black Porgy, Acanthopagrus schlegeli. Biol. Reprod. 2012, 88, 19. [Google Scholar] [CrossRef] [PubMed]
- Tosti, E. Calcium ion currents mediating oocyte maturation events. Reprod. Biol. Endocrinol. 2006, 4, 26. [Google Scholar] [CrossRef]
- Gabriel, B.; Sureaua, F.; Casselyn, M.; Teissié, J.; Petit, P.X. Retroactive pathway involving mitochondria in electroloaded cytochrome c-induced apoptosis: Protective properties of Bcl-2 and Bcl-XL. Exp. Cell Res. 2003, 289, 195–210. [Google Scholar] [CrossRef]
- Stallock, J.; Molyneaux, K.; Schaible, K.; Knudson, C.M.; Wylie, C. The pro-apoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo. Clin. Exp. Obstet. Gynecol. 2003, 130, 6589–6597. [Google Scholar] [CrossRef]
- Rucker, E.I.; Dierisseau, P.; Wagner, K.U.; Garrett, L.; Hennighausen, L. Bcl-x and Bax Regulate Mouse Primordial Germ Cell Survival and Apoptosis during Embryogenesis. Mol. Endocrinol. 2000, 14, 1038–1052. [Google Scholar] [CrossRef]
- Zhang, X.; Li, X.-H.; Ma, X.; Wang, Z.-H.; Lu, S.; Guo, Y.-L. Redox-Induced Apoptosis of Human Oocytes in Resting Follicles In Vitro. J. Soc. Gynecol. Investig. 2006, 13, 451–458. [Google Scholar] [CrossRef]
- Felici, M.D.; Carlo, A.D.; Pesce, M.; Iona, S.; Farrace, M.G.; Piacentini, M. Bcl-2 and Bax regulation of apoptosis in germ cells during prenatal oogenesis in the mouse embryo. Cell Death Differ. 1999, 6, 908–915. [Google Scholar] [CrossRef] [PubMed]
- Greenfeld, C.R.; Pepling, M.E.; Babus, J.K.; Furth, P.A.; Flaws, J.A. BAX regulates follicular endowment in mice. Reproduction 2007, 133, 865–876. [Google Scholar] [CrossRef] [PubMed]
- Chaube, S.K.; Prasad, P.V.; Thakur, S.C.; Shrivastav, T.G. Hydrogen peroxide modulates meiotic cell cycle and induces morphological features characteristic of apoptosis in rat oocytes cultured in vitro. Apoptosis 2005, 10, 863–874. [Google Scholar] [CrossRef] [PubMed]
- Song, X.F.; Tian, H.; Zhang, P.; Zhang, Z.X. Expression of Cyt-c-Mediated Mitochondrial Apoptosis-Related Proteins in Rat Renal Proximal Tubules during Development. Nephron 2017, 135, 77–86. [Google Scholar] [CrossRef]
- Zhang, Y.; Cheng, M.; Wu, L.; Zhang, G.; Wang, Z. Bisphenol A induces spermatocyte apoptosis in rare minnow Gobiocypris rarus. Aquat. Toxicol. (Amst. Neth.) 2016, 179, 18–26. [Google Scholar] [CrossRef]
- Pasquali, M.A.B.; Gelain, D.P.; Zanotto-Filho, A.; de Souza, L.F.; de Oliveira, R.B.; Klamt, F.; Moreira, J.C.F. Retinol and retinoic acid modulate catalase activity in Sertoli cells by distinct and gene expression-independent mechanisms. Toxicol. In Vitro 2008, 22, 1177–1183. [Google Scholar] [CrossRef]
- Wang, X.; Yuan, X.; Sun, Y.; Wu, J.; Zhang, J. Effect of H2O2 on apoptosis of sertoli cell. Chin. J. Vet. 2009, 45, 19–21. [Google Scholar]
- Yang, H.; Yan, X.; Yang, D.; Ren, D. Oxidative stress-induced apoptosis in granulosa cells involves JNK, p53 and Puma. Oncotarget 2017, 8, 25310–25322. [Google Scholar] [CrossRef]
- Nowosad, J.; Kucharczyk, D.; Luczyńska, J.; Targońska, K.; Czarkowski, T.K.; Bilas, M. Changes in European eel ovary development and body and ovary chemistry during stimulated maturation under controlled conditions: Preliminary data. Aquac Int. 2014, 23, 13–27. [Google Scholar] [CrossRef]
- He, Z.; Wu, Y.; Xie, J.; Wang, T.; Zhang, L.; Zhang, W. Growth differentiation factor 9 (Gdf9) was localized in the female as well as male germ cells in a protogynous hermaphroditic teleost fish, ricefield eel Monopterus albus. Gen. Comp. Endocrinol. 2012, 178, 355–362. [Google Scholar] [CrossRef]
- Hu, Q.; Guo, W.; Gao, Y.; Tang, R.; Li, D. Reference gene selection for real-time RT-PCR normalization in rice field eel (Monopterus albus) during gonad development. Fish Physiol. Biochem. 2014, 40, 1721–1730. [Google Scholar] [CrossRef] [PubMed]
Caspase-12 | Cyt-C | Caspase-8 | ||
---|---|---|---|---|
Apoptosis rate | Pearson correlation | −0.377 | 0.705 ** | −0.386 |
Sig. (2-tailed) | 0.063 | 0.001 | 0.056 | |
N | 25 | 25 | 25 |
Primer | Sequence (5′-3′) |
---|---|
bax F | CTTTGCCTGTCGGCTTGTCA |
bax R | ATACCCTCCCAGCCACCTTG |
apaf-1 F | TAAGAACCCCTCTGATGGCTCC |
apaf-1 R | ATTCCAAACACAGTGACCCAGC |
caspase-3 F | GCGGACTTCCTCTATGC |
caspase-3 R | CAAGGTGGCAGCAGAGT |
tnfr1 F | TCCACCTGGGGACTACGCTAC |
tnfr1 R | ACTGTCCAAGAGGGCAAGGC |
calpain F | TGAAGGGCGGAAACACCACC |
calpain R | CTCAAAGCGAGCGGGAACCA |
fadd F | GCCGACACAACGGAGTATCT |
fadd R | TTACCTCTGTGGCGATGTTC |
ef1α F | CGCTGCTGTTTCCTTCGTCC |
ef1α R | TTGCGTTCAATCTTCCATCCC |
rpl 17 F | GTTGTAGCGACGGAAAGGGAC |
rpl 17 R | GACTAAATCATGCAAGTCGAGGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, Z.; Chen, Q.; He, L.; Xiong, J.; Gao, K.; Lai, B.; Zheng, L.; Pu, Y.; Jiao, Y.; Ma, Z.; et al. Cyt-C Mediated Mitochondrial Pathway Plays an Important Role in Oocyte Apoptosis in Ricefield Eel (Monopterus albus). Int. J. Mol. Sci. 2022, 23, 10555. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms231810555
He Z, Chen Q, He L, Xiong J, Gao K, Lai B, Zheng L, Pu Y, Jiao Y, Ma Z, et al. Cyt-C Mediated Mitochondrial Pathway Plays an Important Role in Oocyte Apoptosis in Ricefield Eel (Monopterus albus). International Journal of Molecular Sciences. 2022; 23(18):10555. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms231810555
Chicago/Turabian StyleHe, Zhi, Qiqi Chen, Liang He, Jinxin Xiong, Kuo Gao, Bolin Lai, Li Zheng, Yong Pu, Yuanyuan Jiao, Zhijun Ma, and et al. 2022. "Cyt-C Mediated Mitochondrial Pathway Plays an Important Role in Oocyte Apoptosis in Ricefield Eel (Monopterus albus)" International Journal of Molecular Sciences 23, no. 18: 10555. https://0-doi-org.brum.beds.ac.uk/10.3390/ijms231810555